header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1242
Transcript Name: atp6v1e1b-201
Previous Names: atp6v1e1-001, atp6v1e1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000008574 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000008574|OTTDARG00000007591|ZDB-GENE-020419-11 atp6v1e1b|OTTDARP00000007394 atp6v1e1b-001 LG_ BX323558.7 Danio rerio protein_coding KNOWN, 1330 bp
GGTTCCCATAGAGGAAATACGCGTCATGTGACGTCTGTGT
CATCGTAGACTGAGAATCAGCTGATCCCTCCAGTCTATTT
TCACGGCTCTGACACTGTCACGATCAACCCTTTTCGAGTA
AATTTAAAATCTAAAGGCTTTCAGGATTATTTTCGAGCTG
TATTTGCAAAGCAGACGCCTTTCCTCTGCCGCAAACCGAG
CTTTATCTCTCGGCGGAGTTTAAAATCCCCTTAAAGCAGC
AGGAGCAGGATCTGCAGTCATGGCGCTCAGCGATGCCGAC
GTCCAGAAACAGATCAAGCACATGATGGCTTTCATTGAGC
AGGAGGCCAATGAAAAAGCCGAGGAGATAGACGCCAAGGC
GGAGGAGGAGTTTAACATTGAGAAAGGTCGACTGGTTCAG
ACCCAGCGCTTGAAGATCATGGAGTATTACGAAAAGAAGG
AGAAACAGATCGAACAGCAGAAGAAAATTCAAATGTCCAA
CCTGATGAATCAGGCCAGACTGAAGGTCCTGAAGGCCAGA
GATGACATGATTGCGGATTTACTAAACGACGCACGTCAGC
GACTAGCGAATGTAGCCAGAGATCCGTCCAGATACGCGGC
TCTGATGGACGGACTGGTTCTGCAGGGTTTTTACCAGCTG
CTGGAACCTAAAGTGACCATCCGTTGCCGCAAACAGGATG
TGGGGATTGTGCAGGCCGCCGTGCAGAAAAACATCTCCAT
CTACAAAGCAGCAGTAAAGAACAATCTAGAAGTGCGCATC
GACCAAGACAACTTCCTCTCTCCAGAAATCTCTGGAGGTA
TTGAGCTCTATAATGCGGACGGGAAAATTAAAGTGGCAAA
CACTCTGGAGAGCCGACTGGAGCTCATCGCACAGCAGATG
ATGCCTGAAATACGAGTCGCCCTGTTTGGTGCGAACCAGA
ACCGCAAGTTCATGGACTGATGGATCTTTCTGGAGATCGG
CAGTGTTTTGATGTTGTATTTTTATTTTGATGTTAAAAAT
CCATTCCTGCGTCTCTATCTGTACTGTATTTAAGAAGACA
TCACCTGTGTGTGTGTGTGTGCGTATGATTCATCATTGCT
GTATAAAGATCAAAATAGTGTCCTGCACATTTCTGTGTTA
GATTATGAATAAATTAAAGCTCCGTTATGTTCCTATAAAG
TCTTAAAGTGATGCATAACCCTCGCTTCATGAAGAAAATA
TGACTTTTTTTTTTATTTGCATTCCTGTAATGAGGAGCAT
GATCTGTATATCTGAAGCAAACGTGTCTGTCGATGATGCA
AAAAGACTATATTGATGTGAAAACTATAATGAAAACCCAT
ATGGCCCAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp6v1e1b-201 Contained in:

OTHER atp6v1e1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000008574 (1)
  • Ensembl_Trans:ENSDART00000050221 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067557 (1) 1335 bp
    GenBank:BC057254 (1) 1293 bp
    GenBank:EE306251 (1) 845 bp
    GenBank:AW280928 (1) 471 bp
    GenBank:CB355658 (1) 468 bp
    CITATIONS (2)