ZFIN ID: ZDB-TSCRIPT-090929-11792
Transcript Name: mgst2-202
Previous Name: mgst2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029397 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029397|OTTDARG00000022738|ZDB-GENE-060616-94 mgst2|OTTDARP00000024010 CH211-113D11.2-002 LG_ BX005077.5 Danio rerio protein_coding KNOWN, 1104 bp
GTATTTCCGGTCTCAAAACACGAGGTAATATTCAATTCAG
TCGTGTATACCGACCTAATCTCTCCCGCTTGTAAGAAAAT
ACTGTTCAAAAAGGAGCCGTTGTTGTGTCTGGACCATCAA
CGAATATGACTTCAGATCTCCCAGTTCTCCTCGCAGCTGT
GTCGGTACTGTCTGCTCTCCACATGGGTTTTCAGGCAAGA
CGTGTGGGCTGGTCGAGGATGAAGTTTAAAATTGTGCCCC
CCATTGTTACTGGACCACCTGAGTTTGAAAGGACATTTCG
AGCACACCAGAACAGTGTAGAGTTTTATGCCATTTTCGTG
GTGCTATTGTGGATATCTGGCATATTCTTCAATGAAGTGC
TTGCGGCTCTTGGAGGGCTTGTGTATATTGTGGGCAGAGA
GATGTACTTTACCGGCTACATCAGTGAATCCAAAAGAAGA
TGATAATCAAAACATAAGTGCATTTATAAAGTTATATTCT
GTGAAATTGTGTCAAATTCAATCAAATTACAACCCATTTC
TGCTATTTGTCTTAGGTTGCCAGGGTTTTACTTGGTGTTG
TTTGTCCTGCTATTCCTAGCTGTGACGGCTGCCATTGGAA
TCTTCCAAGCGTTTTTGGACAAATATCTCTGAGGATTTAA
TTCCTGTTATCTATTGCTATCTCAAGTTATCAAACACATA
GATCCCTGCTGAAAAATCCTGCTTGAACCAGCCTAGGATG
GTTGGCTGGTTTTAGCTGGTCGACCAGCCTGGTTTTAGAG
GGGTTTTGGCCACTTCCAGGCTGGTTTCCTTCCATTTCCA
GCCTAGTCTTAGCTGGTCAGGCTGGAAAGTAACCAGCTAA
AACCAGCTTGACCAGCCTGGTTTAAAACTGGACATAGCTG
GTTTTGGCTGGGCTCCCAGTCTGGCTAGGCTGGTCAAGCT
GGTTTTAGCTGGTCATCTCCCAGTTTAGTTTGTCATTCAT
GTAATTATCAAGGTCATTACCTCATGTAGCAGATATTAAC
TATCATCAATTATTTAACTTGCAGCAATACCAATGTAGGA
GGCAATGTCATTCTAAGGTGAATAAAGTGAAATTACAAAT
AAAAAGGATCTGCATGCTTTTACA

mgst2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mgst2-201 (1) 991
mgst2-202 1104
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mgst2-202 Contained in:
OTHER mgst2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029397 (1)
  • Ensembl_Trans:ENSDART00000142317 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095059 (1) 1120bp
    GenBank:CN168048 (1) 882bp
    GenBank:CN170049 (1) 789bp
    CITATIONS (2)