ZFIN ID: ZDB-TSCRIPT-090929-11791
Transcript Name: mgst2-201
Previous Name: mgst2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029396 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029396|OTTDARG00000022738|ZDB-GENE-060616-94 mgst2|OTTDARP00000024009 CH211-113D11.2-001 LG_ BX005077.5 Danio rerio protein_coding KNOWN, 991 bp
ACGTATTTCCGGTCTCAAAACACGAGGTAATATTCAATTC
AGTCGTGTATACCGACCTAATCTCTCCCGCTTGTAAGAAA
ATACTGTTCAAAAAGGAGCCGTTGTTGTGTCTGGACCATC
AACGAATATGACTTCAGATCTCCCAGTTCTCCTCGCAGCT
GTGTCGGTACTGTCTGCTCTCCACATGGGTTTTCAGGCAA
GACGTGTGGGCTGGTCGAGGATGAAGTTTAAAATTGTGCC
CCCCATTGTTACTGGACCACCTGAGTTTGAAAGGACATTT
CGAGCACACCAGAACAGTGTAGAGTTTTATGCCATTTTCG
TGGTGCTATTGTGGATATCTGGCATATTCTTCAATGAAGT
GCTTGCGGCTCTTGGAGGGCTTGTGTATATTGTGGGCAGA
GAGATGTACTTTACCGGCTACATCAGTGAATCCAAAAGAA
GGTTGCCAGGGTTTTACTTGGTGTTGTTTGTCCTGCTATT
CCTAGCTGTGACGGCTGCCATTGGAATCTTCCAAGCGTTT
TTGGACAAATATCTCTGAGGATTTAATTCCTGTTATCTAT
TGCTATCTCAAGTTATCAAACACATAGATCCCTGCTGAAA
AATCCTGCTTGAACCAGCCTAGGATGGTTGGCTGGTTTTA
GCTGGTCGACCAGCCTGGTTTTAGAGGGGTTTTGGCCACT
TCCAGGCTGGTTTCCTTCCATTTCCAGCCTAGTCTTAGCT
GGTCAGGCTGGAAAGTAACCAGCTAAAACCAGCTTGACCA
GCCTGGTTTAAAACTGGACATAGCTGGTTTTGGCTGGGCT
CCCAGTCTGGCTAGGCTGGTCAAGCTGGTTTTAGCTGGTC
ATCTCCCAGTTTAGTTTGTCATTCATGTAATTATCAAGGT
CATTACCTCATGTAGCAGATATTAACTATCATCAATTATT
TAACTTGCAGCAATACCAATGTAGGAGGCAATGTCATTCT
AAGGTGAATAAAGTGAAATTACAAATAAAAA

mgst2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mgst2-201 991
mgst2-202 (1) 1104
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mgst2-201 Contained in:
OTHER mgst2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029396 (1)
  • Ensembl_Trans:ENSDART00000136045 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC117619 (1) 931bp
    GenBank:EH581891 (1) 915bp
    GenBank:EH542808 (1) 910bp
    GenBank:CN836605 (1) 872bp
    GenBank:EH605729 (1) 838bp
    GenBank:EH588285 (1) 810bp
    CITATIONS (2)