ZFIN ID: ZDB-TSCRIPT-090929-11743
Transcript Name: ppme1-201
Previous Name: ppme1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029341 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029341|OTTDARG00000022697|ZDB-GENE-030131-7064 ppme1|OTTDARP00000023962 DKEY-92K1.3-001 LG_ BX510938.12 Danio rerio protein_coding KNOWN, 1722 bp
AAAAGTGCTGGTGGGTGGAGACTACTGGTGCGAACATAGA
TTTCTGTACCTGTCTGCTGAGCTAGTCCGATTTATCGTTC
ATTTCTCTTAAGTGTGCAGTTGCAGTGTGTATAGAAGGCG
ACTCGTATGGTGCAAAGAAAGCTAGACGTTTTAGGCGCTC
AAAGGGTTTGGTTTTCCTCACATCATGGAGAAACAGTTGC
ATTTGAATTTGCTAGCCTCTAAGCCCCCAATGGCAGGTTT
GCAGTCGGGATCTAAAATAAGAATGGGACCAGGAAGAAAG
CGAGATTTCTCTCCCCTTCCATGGAGTCATTACTTTGAAA
CTATTGAGGACGTGGAGGTGGAGGTGGAAAATGACAACAG
CAAAGACACATTCAGAATTTACAGCAGTGGCTCTCATGGT
CCCGTCCTGCTGCTTCTGCATGGAGGAGGTCACTCTGCTC
TGTCCTGGGCCGTCTTTACTTCTGTTATTTGCAGCCGGAT
CACCTGCAGAGTTGTAGCGATGGACCTCAGAGGACATGGT
GATAGTAAAGTAAAGAACCCGGACGACCTCTCTGCTGAAA
CAATGGCCAAGGATATTGGAAAAGTGGTGGAGGCACTTTA
TGGTGAAAACCCACCTCCAATCATGATTATTGGACACAGC
ATGGGCGGAGCTATAGCAGTTCACACAGCTGCAGCCAATC
ATGTGCCATCTCTGCTTGGTCTTTGTGTTATCGATGTAGT
GGAAGGCACAGCAATGGATGCCTTGAACAGCATGCAGAAC
TTTCTGAGAAGTCGACCAAAAACATTTAAATCAGTGGAGA
ATGCAATTGAATGGAGTGTGAAAAGTGGCCAGATCAGGAA
TGTTGAATCTGCACGAGTGTCTATGGTTGGACAGGTGAAA
AAATGCGAGGAGCCACTGAGTAGTCCAGGGGTTTCCAAGA
GCATCAGTGAAGGCATCATTGAAGAAGAAGAGGAGGATGA
AGAAGGAGGAGAATCCAACCATAAAAGGAAGAAAGAAGAT
GACCAAGAGATAAAGAAGGAATCTCTGTACACCTGGCGTA
TTGAACTCTCAAAGACAGAGAAATACTGGGAGGGCTGGTT
TAAAGGACTGTCTTCCCTCTTTCTCAGCTGTTCTGTGCCA
AAACTTCTTCTGCTGGCTGGTATTGACAGGCTTGACAAAG
ATCTTACCATTGGGCAAATGCAAGGGAAGTTCCAGATGCA
GGTTCTGCCACAATGTGGCCATGCCGTTCATGAAGATGCC
CCAGAAAAAGTAGCTGATGCTTTAGCCACTTTCATGGTTC
GTCACAGGTTCACTGAATTAAAGGAAGGGTTCCCCTGACA
ATGTGTAGCCTCCACTCGTAGTCTTCATCCAGCGCTGTCA
TCCCTCTCTGCTCTCCACCAGAGACTACAATACAACCAAA
ACCATGATGACGCCTTCTGCCAAACTCATTCTTAGCACTT
CATTCTTAAATTATATTCAGTTTTGTATGACTTTATGTAT
GTTTACTGTAGTCATCACAAGTCATATGGCTATTTTGGCA
GGAAATAATTAATTCAATAATACTCATGATTTCAAATTGT
TATGTATATTTAAATTTTTATTTTCCCCTGAATTGGTTTC
TTTTGCATTTCTTTCGATGCCTTTGCTTGTTTGTTGTTGT
AATTAGGATGATTGCATTATGTTGTGTTTAAAGTGTTGGT
CGTTGCTGATTTCAAGGGAAATAATAAAGTGAGGTTTAAG
CA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppme1-201 Contained in:
OTHER ppme1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029341 (1)
  • Ensembl_Trans:ENSDART00000016219 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071447 (1) 1744bp
    GenBank:CK026070 (1) 770bp
    CITATIONS (2)