Transcript

zgc:86764-201

ID
ZDB-TSCRIPT-090929-11738
Name
zgc:86764-201
Previous Names
  • zgc:86764-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029336 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029336|OTTDARG00000022693|ZDB-GENE-040718-435 zgc:86764|OTTDARP00000023957 CH211-108A2.1-001 LG_ BX511179.5 Danio rerio protein_coding KNOWN, 2100 bp
GAAGAAGAAAAGAAAACGTCAGCTGCAATTCAAATTTTAC
CGCTCGTCCTGTGCACAACGAGACGATAGTTGTTAATATT
GATAGGTGATTTATTTTTAATATAATTACTGACGGTTGTC
ATACGGTCCAATGATGACTTGTCGAAAAAGTGAAGCTTTG
GCGTTCTCTCTTGTGACTGAGATCAATCATGCGATGGCCA
GGCTTGTGGACATATGGGACAGCATCGGCATCATGGAGGA
CCAGAGAGTGGAGAGAATGCAAACTGTAAAAAAGCATATA
GATGGCCTTTTACATTCCATGATCATGGAGGAAGAGGCTT
TAAGACATCGAATCAAAACAGATATCATCACCTTCCAGAA
GCAACTGGACACGCTGTGCCTTGAACTGACTCTTGAACCG
TTCAAATTGGAGGAAAAACTTACAGTTCTCCAGATGGAGA
AGAACCTGCGCTGCCACGTTGAGTCTCTTCAGAAAGAGAA
AAATGAACGTTTGAGAGAGATGAACGATTTTAAGAAGCAG
GACGAAGAGCTGTGTGTGACTCTGTGTGCCGATCCATATT
ATATCCCTACAGGAAGTGTGCCCTCTCGAACACAGTTGCA
GGAACTCAAGGAACACGTCGAGAGACTCAACAAGGAAAAA
GAGAGCAGGGTGAAAGTGTTTTCTGGGCTCCGGGAGGACA
TCAGGAATTTGATGGAAGAGTTGGGACATGAACCAGAGAG
CAGTCTGGAGCGGGAGTCTATCTGCCCCGATGCTGACATT
TTTCTGCTCACGCATGACAATATCAAAGCCTTGAAACTGC
TGCTCAGCCAGCTTGAAATAAAAAAGGAGTCCTTAATTTC
GGCACGAGACAGTCTCAAGGAACGAGCCATGAGCCTGTGG
AATCGTCTGAGCTGTCCCGAGTCGGAGGCCGAGGTGTTCC
AGGAGCCAGCTATGAGCACTCTATCTGATGATATCAGACG
GTGGCAGAGGTTTGTGGAGCATCTGGAGGAGCTGCAGAAG
GCTCAGCTAGAGGAGGTGATCAATAAGGTCCGACAAGAGC
TTGTTGTTCTCTGGGACAAGTGCATGTTTGGGCCTGACCA
GAGACAAGCGTTTGATGTTCACTTTTGTGATGATCAGTAC
ACCACGGAGCTGCTGGCCCTCCATGACTCTGAGCTACTGA
GAATGAAGATTTTCTATGAGGAAGCACAGCCCATACTGGA
GGACCTGGAGAAATGGAAGAGGAACTGGGCTCTCTTTCAA
GAGTTTGAGAGAAAGGCTGCAGATCCCAGTCGCTTCAGTA
ACAGAGGAGGTTCTCTGCTCAGAGAGACTAAGGAAAGGGG
CAAAGTGCAGAAACTGCTCCCAAAGCTGGAAGAGGAGTTG
AGAGGCCGTGTGGAAGATTGGGAGATAGTTAAGGGTTTAT
CCTTTCTTGTGTATGGTCAAAGAGTCATGGATTACATCTC
CAGCCAGTGGGAAGAGCATCGCTTGCAGAAAGATAAGGAG
AAGAATGAAAGGATGTCGAAGAAAACTGAAACCCCTCAAT
TTAAAACTCCAACAAAGAGAGCCCATGGAATGACATGTGC
TGCCACCCCAACCCCTAACAAAATCAGAAAGACGCCCAGT
CAGCTGGCTCCTCGCTCTGCCACTGTGAGCAGCATCAGCA
GCGCCAGCAGCAGCGGCTCCTCCACCACCTTCTTGTGTGT
GCCAGGAAGACCTCAACTCTCTGCCAAGAGGACCAAGACC
ACTGAGACCAGTACTGGCCCACGTTTGCCGCTGCAGGATT
TCAACAGTGACAAGAAACCAGTTCAGATGAGCTACTCTGC
ATTTACCAGTGAGTTCTCCAGGAAAGCAAACGGTGATGCT
GTTCTCAATTCCACTGTTAAAGATGTCCTCTGATTGGATG
GGGAAATTGTTTACCTTTTTTAAAATAAAATACAAGGTTT
AGGTCAATGACAGGTCAATCATGTCAGAATTGAGAATGTA
CAGGATTCAATTCGCGGGTGTTTTTCTTATCGACATTTCA
TATGTAGTTTTTGTTTGTTTTTAAAAAAGGCACAATTATT
TATATATATTTTTACAATAAAATGCTACTTTTAATAAAAA
GCTTCTTTATACATTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations