ZFIN ID: ZDB-TSCRIPT-090929-11711
Transcript Name: tmem144b-201
Previous Names: tmem144b-001, zgc:103560-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029301 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029301|OTTDARG00000022675|ZDB-GENE-041010-58 tmem144b|OTTDARP00000023931 tmem144b-001 LG_ CT009687.10 Danio rerio protein_coding KNOWN, 1505 bp
AGACTCTGGAAACTACGGTCAATCTGAAAAGCAACACTAA
TTACTGACACCTGCTTTTCAAACCTGACTGCTTTGCCTCT
ACAACAAATGTAGTGTTTATCCGCGAGTATAAGACACTGA
GATGGCTTTTCTGGCTGTAATTGTGCTTTTGCTTGTAAGG
AGCTGTTGCACATTGGCAGTTGAAGAGCCTTCTGGTGATG
ATGCTGCGTTGCCTTACAATAAAGTGCAGAACAGTGCAGA
AACCACCTATGGCTATGTGACCTGTGCGTTTGCAGTGCTG
TTGTATGGAAGCTATTTTGTTCCTATGAAAAGAATAGAGA
CCGGCGATGGAATGTTTTTCCAGTGGATTTGCGCTTCGGG
TATATGGTTTGTTGGACTGGTTGTTGACACACTGTTTCAC
CCATCCAAAGCTCATCCAGCTGCTATGCTTGGAGGAGCAC
TTTGGGCCACAGGACATGTAAGCGCTGTCCCAGTAGTTAA
GTTTATTGGACTTGGACTTGGGATTTTGCTTTGGGGATCC
AGTGCATTGCTAATTGGATGGGCAAGCTCAAGGTTTGGCT
GGTTTGGACTGCATCCAGAAGAAGTATCAAAGCCTTTGCT
CAATTACTGTGGTGCTGGCCTTTGTCTTCTAAGTGCCATC
ATATTCTTCTTTGTGAAAAGTGATGGTCATCAACGCACGT
CCACTGAATTTATGCCTCTGTTGATTGATGATAGGAGGCT
GGATCCAGACAGCATAAGTCCCAGTGATTCATGGGTGGAC
ACAATTTCCCCGAAGAGCAAGAGAGTGTTTGGCTGCATCT
TGGCAGTATTTTCAGGTGTCCTTTATGGCAGTGCATTTGT
GCCTGTTTTTTATATGAAATTGCACGCCACAAATAATTCA
AGCATGTTCATTGGATCCAGTCAAAATGAAATTGACTACT
GCTTCGCCCATTACAGTGGAATTTTCCTCACAAGCACAGT
GTATTTTCTCGCTTACTGTGCAGTCATGAAAAACAGGCCT
CGGATCTATCCCAGAGCCATCTTACCTGGTTTTTCAAGTG
GCCTGATGTGGGGATTGGCCACATATTCTTGGCTTATGGC
AAATTACTACCTTGGTGCAGTGATCACATTCCCTATAACT
AATGCTGGTTATTCCTTAGTAGCTGCTTTGTGGGGAAGTG
TGGTATTTAAAGAGGTCAAGGGCATTGGAAACTTGCTGTT
GTTTGCTTTGGCAACTTGTGTTGTGCTGGCAGGCTCCTTC
TTAACTGCCTATTCAAAGATCTGAGCCTGGATGTTAAGTT
ACCACAAGGTGGCAATAGTGGATCAGGTTTTAAATTAATA
TTCCTGCCAAACTTTGCAGTCACTTTCTCATTACAGTACG
TTTCATGAGTCTTCTGCAGTTGCTTGGTAGCCCCTGATGA
ATTTTGGACTTTTTTTCTGCTTTTGCATTTTAACTGCTGT
CAATTAATTATATGTGTTCTGTAAGTTCATGAGGATTTCA
ATTAAACCATTTCCCCTTTTCTGGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem144b-201 Contained in:
OTHER tmem144b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029301 (1)
  • Ensembl_Trans:ENSDART00000052648 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC083426 (1) 1463bp
    GenBank:EH545586 (1) 948bp
    GenBank:EH566722 (1) 936bp
    GenBank:CN177902 (1) 874bp
    GenBank:EH533494 (1) 801bp
    CITATIONS (2)