header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11486
Transcript Name: pfkfb4a-201
Previous Name: pfkfb4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029055 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029055|OTTDARG00000022540|ZDB-GENE-051120-51 pfkfb4a|OTTDARP00000023755 DKEY-25G11.1-001 LG_ BX548160.13 Danio rerio protein_coding KNOWN, 1977 bp
ACTGATGGTTATGGACGCTCGAGTGTAGAGACGACGGAAT
ATAATGAGTTTAATAGAGAACAACACGGAGCAATGCGGCA
ATAGTCTGACCCGAGAGCTCACCCAGAATCCTTTAAAGAA
AATATGGGTGCCATCCTCCAGAAACGGCCTTCCTGACAGG
CACATTAGTCAGAAAAAGGTATGCATGACAAACTGCCCTA
CGCTTATAGTAACCGTCGGTCTGCCCGCCAGAGGAAAGAC
CTACATCTCCAAAAAACTGACACGCTACCTCAACTGGATT
GATGTTCCTACGAAAGAGTTTAACGTTGGCCAATACAGAC
GAGAATGTGTTAAGATCTACAAATCCTTTGAGTTTTTTCG
ACCAGACAATGAAGAGGGGCTCAAAATCAGGAAGCAGTGT
GCACTGGCAGCTCTCAATGATGTCCGGCAGTTCCTCACAG
ATGAAGGTGGACAGGTGGCGGTTTTTGATGCCACAAACAC
GACAAGAGAAAGAAGAGACACAATCATCAGATTTGCAGAG
CAGAACGGTTTCAAGGTGTTCTTTGTAGAGTCTGTGTGTG
AAGACCCTGACGTTATCGCTGAAAACATTGTGCAAGTGAA
GCTGGGCAGTCCAGACTACACACACTGTAACACAGAAGAG
GCCGTCGCTGACTTTATGAAGAGGATAAAGTGTTATGAGA
ACTCCTACCAACCCCTGGATGAGGAACTGGACCGGGATCT
TTCCTTCATAAAGATCATTGATGTGGGCCGAAGGTACCTA
GTGAACCGGGTTCAGGACCACATACAGAGCAGAATAGTTT
ACTACCTCATGAATATCCACATCACGCCGCGGTCCATCTA
CTTGTGCCGGCATGGAGAGAGTGATCTGAACATTAAAGGC
CGAATCGGAGGAGATTCAGGGCTTTCAGCAAGGGGAAAGA
AGTATGCTGAGACTTTGGGTCAGTTTATCCAGTCGCAGAA
TATTCACGAATTGAAAGTGTGGACGAGTCAGATGAAGAGG
ACCATACAGACGGCAGAAGCTGTGGGCGTACCGTACGAAC
AGTGGAAAGCTCTCAATGAGATCGATGCCGGTGTCTGTGA
GGAGCTCATGTATGAGGAGATCCAGCAGCGATATCCGCTT
GAGTTTGCATTACGGGACCAGGATAAATATCGATACCGCT
ATCCCAAAGGAGAGTCCTATGAAGACTTGGTCCAGAGGCT
GGAACCCGTGATCATGGAGTTAGAAAGGCAGGAAAACGTT
CTGGTCATCTGTCATCAAGCCGTCATGAGATGCTTGCTGG
CCTACTTTCTGGACAAAACAGCAGAGGAATTGCCTTATCT
GAAATGCCCTCTACACACAGTATTGAAGTTAACACCAGTG
GCCTATGGTTGCAAGGTGGAGTCGATTGATTTGAAAGTGG
AAGCTGTGAACACACACAGAGACAGACCGACGAACGTAGA
TGTGTCTCGGCTGGCGGAAGAGGCTTTGTTAACAGTACCA
GATCATCACTGAACGTTCCTCACAACAACATTATCTCATT
CCCATTTTATTCCAATCCTAAAATGCATTTGACACCTCAG
AGATTATGAAGCACTTGAGTCATTCAGATTTGTGTTCTTG
TGTTTAATATTAAATTGCACTTTATTCTAAATGCACACAT
ATATACATATGAATTCATCTGCTGCTATGAAAGATCACTC
CAGAGGCACATTATATTTATTTATGGTAAATTAGGATGAG
GAGTTATGTATTCATAATGTAGGAATGTCTATCATGTATA
TAAGAGCAGTGATATTTTTGTTGCTATCAGAGCCTTATGG
TGCTTTCGGATGAAGGACGTTTTTAAATCATTTTACTTTT
TTATTGTAGTAATTTATCTTTTTGAAACACTAAGGAATCA
TGCTATGATAATGTGAACCCTCTTCTTGTGAGTGAGAAGA
GTAAATCTCTACTGTGATGTCTGTTTGCGATGCTAATAAA
CTATTGGAATAGTGAAA

pfkfb4a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pfkfb4a-201 1977
pfkfb4a-202 (1)    Ensembl 1452
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pfkfb4a-201 Contained in:
[BAC] DKEY-25G11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029055 (1),  Ensembl_Trans:ENSDART00000077883 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC109443 (1) 2002 bp
CITATIONS (2)