ZFIN ID: ZDB-TSCRIPT-090929-11274
Transcript Name: nuf2-203
Previous Names: nuf2-002, zgc:56708-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028832 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028832|OTTDARG00000022404|ZDB-GENE-040426-1121 nuf2|OTTDARP00000023580 nuf2-002 LG_ CR855375.8 Danio rerio protein_coding KNOWN, 914 bp
GCCTAAAGTTTAAAATTTGCTTCAGTTGACGGCGAGGGAC
GTTGTTGTGAACTTGGCTGCAGACATGTCTGAAAACACGT
TCCCGGTGTACAAAGTGGATGTTATAGTGCAGTTTTACCG
AACTGAGGTTTTGACTGGACAAGAGTCTAAACATTTCACC
AAGAATGACCTCACTCCGACTCCTAAGCCAGAATCCGTTC
AAAGGCTCTACATGAGAATTTTGCAGCTTCTCTTTCGTTT
CAGACCTGAGTGCCATTACACGGTGCCGCTGTCTGAAAAC
ATTCAGTACCCGATGCTGTACGAGTCGTTTGCTCCAATCA
TGAGCGTTTACATGCGCATGTGCCAGTTTTTACCGGTCTG
CCGTGTGTATGATTTTTCACTGAGTGATCTGCTCAACCCC
AAGACGAAGCGAACAATCACTATACTCAGCGCAATCCAGA
ATTTCCTGCACTTCAGAAAGCAGAGGTTGGAAATTACTGC
AGCCCACCAGCAAAGTTTTCGAGCTGATATGGACCGACTC
CAGGCATACACAAGAGAAATAAAAGAGGCTGAGAAGAAGA
TTGAGAAGCTGACTACCATACCACCAGAGCAGCAAGCAGA
AGCTAAAGAGCTGGCGTCCGCCCTGGCAGAGCTGAGCACT
AACACACAGCATGAATACCAAGATGTGAGCGCAATTAATG
AAAAGGTTGCACAGTTCAAGACGGAAATTGCGGAGCTGTC
ACAGAAACTGACTCAAAGGAAAGTAGAAGTGGCGACACTG
AAGGATGAAATATCAAAGCTCAAGTCTCAGATCGTGGAGT
CGCCTGAAGAGCTGAAAAATGAAATGGAAAGAATGAGAGA
GACTGCGAAGAACATCAAGATGTCGAAAGAGCTGGCGGAT
GAGCGGCTGGTGGAGCTGCAGATGCTGGTTCAGT

nuf2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nuf2-201 (1) 1567
nuf2-202 (1) 542
nuf2-203 914
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nuf2-203 Contained in:
OTHER nuf2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028832 (1)
  • Ensembl_Trans:ENSDART00000137121 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN020334 (1) 881bp
    GenBank:EE315600 (1) 861bp
    GenBank:DT065154 (1) 791bp
    GenBank:EB794083 (1) 450bp
    CITATIONS (2)