ZFIN ID: ZDB-TSCRIPT-090929-11273
Transcript Name: nuf2-201
Previous Names: nuf2-001, zgc:56708-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028831 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028831|OTTDARG00000022404|ZDB-GENE-040426-1121 nuf2|OTTDARP00000023579 nuf2-001 LG_ CR855375.8 Danio rerio protein_coding KNOWN, 1567 bp
GTTGTTGTTATGAGGGCGGTCTGTGTTGTGCCAGTAAACA
GTGAAGTGTCGCTCAGTACTTCATTACAGTCATTTGTTTC
TCTTGAGCAGCAGACATGTCTGAAAACACGTTCCCGGTGT
ACAAAGTGGATGTTATAGTGCAGTTTTACCGAACTGAGGT
TTTGACTGGACAAGAGTCTAAACATTTCACCAAGAATGAC
CTCACTCCGACTCCTAAGCCAGAATCCGTTCAAAGGCTCT
ACATGAGAATTTTGCAGCTTCTCTTTCGTTTCAGACCTGA
GTGCCATTACACGGTGCCGCTGTCTGAAAACATTCAGTAC
CCGATGCTGTACGAGTCGTTTGCTCCAATCATGAGCGTTT
ACATGCGCATGTGCCAGTTTTTACCGGTCTGCCGTGTGTA
TGATTTTTCACTGAGTGATCTGCTCAACCCCAAGACGAAG
CGAACAATCACTATACTCAGCGCAATCCAGAATTTCCTGC
ACTTCAGAAAGCAGAGGTTGGAAATTACTGCAGCCCACCA
GCAAAGTTTTCGAGCTGATATGGACCGACTCCAGGCATAC
ACAAGAGAAATAAAAGAGGCTGAGAAGAAGATTGAGAAGC
TGACTACCATACCACCAGAGCAGCAAGCAGAAGCTAAAGA
GCTGGCGTCCGCCCTGGCAGAGCTGAGCACTAACACACAG
CATGAATACCAAGATGTGAGCGCAATTAATGAAAAGGTTG
CACAGTTCAAGACGGAAATTGCGGAGCTGTCACAGAAACT
GACTCAAAGGAAAGTAGAAGTGGCGACACTGAAGGATGAA
ATATCAAAGCTCAAGTCTCAGATCGTGGAGTCGCCTGAAG
AGCTGAAAAATGAAATGGAAAGAATGAGAGAGACTGCGAA
GAACATCAAGATGTCGAAAGAGCTGGCGGATGAGCGGCTG
GTGGAGCTGCAGATGCTGGTTCAGTGTGCCAGTCAGGTGG
AGGCAGAAATCCAGATCCTGCTCAAACAGCTGCAGGACTT
GCAGAGCAGCATGAGCAAGACCAAACAGCGAAAAGAGGAG
GTTCAGAGTTTAGAAGTCATGAATGAAAGCTTGCAGAAAG
AGCTGAAAAGCCTGAGCAGTGAAGAAGCCCAGCTGAAGAG
GGCGCTCACCATGAAACTCGACAAGGAGTCCAAACAACAG
ATTCGTAGACAGAAGAAAAAAGAGGTGAAAGATCAGCAAG
TCAAAAATATTTATGGACAATATGACAAAATGCACCAGAA
ACGGCAGGAAATTGTGAAAAAAATTGAAGAATGCAACCGT
GAAACAAAACAGTTTAAGGAAAAAATGCAGGCACTGAGAG
AGAATTGCAATCAACGGACTCAAAAAGCCCAGGAAATTTA
TGAACGACTCCTCACAACATTGGAGCAGTATCACAAGCGG
ATCGAAAAGATTTTGGTGGAGACTAATGCTGACGCTCTGA
AAATGAAGTCACATTTCTAGAGTGATTTGTTTGTACAATG
GTTGTGTCATTTGTTTCATTGTGTTTGTGTGTTATGTATT
GTCCCCTCTCCTTTACATTCAAAAGATGAATGAACAGTTG
CATTTAC

nuf2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nuf2-201 1567
nuf2-202 (1) 542
nuf2-203 (1) 914
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nuf2-201 Contained in:
OTHER nuf2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028831 (1)
  • Ensembl_Trans:ENSDART00000040812 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC050181 (1) 1640bp
    CITATIONS (2)