header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11175
Transcript Name: pabpn1l-202
Previous Name: pabpn1l-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028723 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028723|OTTDARG00000022324|ZDB-GENE-080709-5 pabpn1l|OTTDARP00000023485 CH211-168O15.2-003 LG_ BX248306.5 Danio rerio protein_coding KNOWN, 648 bp
TAACTTGTGGCTGATGCTAAAAACCAGCGTGGATCCAACA
GTCTGGAAAATTGCCTTGTTTCTTCAGGAGCTGGATGCTG
TTCAAGCTTGTGTGCTGGAAATGGACGAGTCTGACATGCA
GTATGAGGTAGAGAGACAGTTTCCCTACAGCCCTGAGGCA
GAATTGTTCTTCGACATGACCCATGAAGAGAGAATAGATT
CTGATAGGAGATCTATCTATGTGGGGAACGTGGATTATGG
AGCAACTGCAGACGAATTGGAGATGTACTTTAATAGCTGC
GGTCACGTTAACAGAGTTACAATCCCGTATAACAGATTCA
CAGGCCATCCAAAAGGTTTTGCCTACATTGAGTTCTCCGA
TAGGGAATCTGTAAGGACTGCCATGGCTTTAGATGAAACT
CTATTCAGAGGGCGAGTCATTAAGGTATCGCCAAAAAGAA
CAAACATTCCAGGTTTCAGTACTACAGACGTGTACTTGCG
TGGAGGCTGGTCTCGAGGACGAGGTGTCCGCGCCTCCAGA
TTTAACCCATTCAGAGGCTGCCGCTTTATTAGGGAAAATG
GAAGAGCTCATCCTTGGGTTGATTCTTTTTGATCTTTCAG
TTATCTTCCTAGCACTTCTCGGTGCTTATTAATTTATTTT
TCTGCAGT

pabpn1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pabpn1l-201 (1)    Ensembl 927
pabpn1l-202 648
pabpn1l-203 (1)    Ensembl 652
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pabpn1l-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028723 (1),  Ensembl_Trans:ENSDART00000135304 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BQ617312 (1) 650 bp
CITATIONS (2)