header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11118
Transcript Name: dgcr2-201
Previous Name: dgcr2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028645 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028645|OTTDARG00000022284|ZDB-GENE-040718-404 dgcr2|OTTDARP00000023420 dgcr2-001 LG_ BX005309.14 Danio rerio protein_coding KNOWN, 6027 bp
GGCGGAGCCATCTTGTTTTATATCCGTCCTAAGCCCGTTT
ACCGAGCCAGAGGAAACAGCTATGGATTATAACACTATTT
CCCAAACGTAGACGCGTGAAATAAAGAAACCCGAGCACCG
AACCTCCTTTATATTCGACGGAATAAACCGAATGGGTGTT
GATTGTGATTAATCGGTGCATTTTCTCTCGCACATTTTCT
CCGGTGTAAGATACCATGAATGGAGGATAAATGTTGCCGA
AGGCTGACAGCGGTGGTTTTGTGCTTCTCCTCTTCATTCT
GACAGTAACAGACCCGCCAAGGACAGGTCCGCGGCTCGCT
CTGGCCAGACTGTTGACAGATCTGCGCTGCAACCCTGGCC
AGTTTGCCTGCCGGAGTGGAAAATTGCAGTGTATCCCGTC
AACCTGGCAGTGCGATGGCTGGACGGCCTGCGAGGACAAG
AGCGATGAGATAGACTGCCCTACTATAAAAGAGGAACGCT
ATCGATACAGCAATGGCCTGGAGCCGGTCGAGGACGTCAT
GGGGGTCGCTCAGCCCGTGCGCTTCAACAAGAAGTGTCCG
AGCGGCTGGCACCACTACGAGAAAACGGCCAGCTGTTATA
AAGTCTACCTGCGCAGTGAGAACTACTGGCAGGCGGTGGA
AACCTGTCAGAAAGTCAACGGCTCGCTCGCAACCTTCGGC
ACCAATGAGGAGCTGCAGTTCATCCTCAAGATCGAGGTGG
ACTTTGACGAGAACGTGTGCGAACGCAAGGACCAGTGCAA
GTTCTGGGTTGGATATCAGTACGTGATCACTAACCAAAAC
CACACGCTCGAGGGACGCTGGGAAGTGGCTTATAAAGGGT
CCATGCAGGTGTTTCTGCCTCCGGAGGGTCTTGAAGCCCT
CGGTGAAGCCAATCCCACCCAGGACAATGTTTTCTGTGCT
CAGCTGCAGCGTTTCCAGATCAAGAGCATGAATGAGCACG
GTCTGCACAGCTGGCATGCAGAAAACTGCTACAAGAAATT
CCCTTTCCTCTGCAAGAGACGACAGACGTGTGTGGACATC
AAGGATAACGTGGTGAACGAGGGCTATTATTTCACACCTA
AAGGCGATGATCCATGTCTGAGCTGCACGTGTCACGACGG
AGAGCCGGAGATGTGTGTTGCAGCTCTGTGTGAGCGTCCG
CAGGGCTGTCAGCACTTCCGCAAAGACCCCAAAGAGTGCT
GCAAATTCACCTGTCTGGACCCCGACGGCAGCAGTCTGTT
TGACTCGATGGCCAGTGGGATGCGTCTGATCGTCAGCTGT
ATCTCCTCTTTCCTCATCCTGTCTCTGCTGCTCTTTATGG
TGCACAGACTGAGACAGCGGCGGCGCGAGCGCATCGAGAC
CCTCATCGGAGGAAACCTGCATCATTTTAATCTGGGTCGG
CGGGTGCCCGGCTTCGACTACAGACCGGATGCATTCGGGA
CGGGCCTGACACCTCTGCATCTCTCGGATGATGGAGAAGG
AGGAGCGTTTCACTTCCAGGAGCCTCCACCACCATACGCT
GCTTACAAATACCCAGACATCCACCACCCCGACGACCCAC
CGCCTCCATACGAGGCCTCCATCAACCCCGACAGCATCCT
CTACATGGATCTCGGTCGGGCAGGTGTTCCTCTGTCGTCC
GGCCACATGGGCAGCACCTCAGACTCTCTGCAGAGAGATT
TCCCTGCGCCGCCGCTGGCCGTCCCGCCACCACTGGAGGA
GCGCGAGGACTCCATCGACAGCAGCACAATGCTCGTCTCT
CCGGACACACCGAGCGGCTCCGAGGCCAGCATCACGCAGA
GCTCCAGCGCGGACGCACCCTCGCTCAGCACCGTGGTCTA
AACCCAAAAACCAGACTTCACAACAGAAGACGTGCACTGG
GGGTTTTTACTCCACGCTTTTTCACGTGTAAATACTTCCG
TCGGCCATTGGTTGAGTCTTGAGGACGAGTGATTTTGCAC
TGGCAAAGACGTTTGTTTGATAAGGAAACGAGTGGACGTC
CCGTCACTGGAGTCCTGTCCTGCACACTGACTCTTTCTGG
CACAAAACAAGCAATGTTATTTTTCCTTGAGCGCTCCAAA
CAGACCCTTCTGATGATGCGTTTTTATGAAGGATCTGTTT
GGGTTTGAGCAAAACTGTGTTCTTAATCTGCAATTCTGTG
ACGTCTGCTTGACTTCTTGTTTATTTTGTCTGTCAGGTCA
GTAACACAAACTCTAAAGCTCTAAAAAAAATATATAATAA
TATTTTACATTGAGGTACGAGTCGGTTTTGGGATACTTTT
AAACACCCTGCTGTGACGTGATGATGATGTTTGTGGAGAA
GATTTCCATCAATACACTATTCGTTTTGTTAACTTTTCAT
TTCATCGATCAGTTTGGCATCTAAAAGGATGAATCTTATT
AAAAGGGCCAAGAAATTACTCATTTCCACCCAAAGCAGAA
ACAAAATGTGATGTTACCTACTCAAACAAGCCCAAATTAT
GTTAACTTGGCTTTAATGGGTCACATATTCTAAAGGAAGT
CCCTTTTTCTTTACAGTAATGCTGGAAAAAATGTTACAAA
TGTGAATAATTTCACTAAAAATGAATATTGTGTCATTATT
TACTCATCCACCTCGTTTCAAACCTGTTTGAGTTTCATTC
TCCTGTTTAACACAAAAGAAAAAAAAGGAATGTTGGAAAA
AAGGGGGCCCAGCTGGCATTTCTGTGTGGAGTTTGCATGT
TCTCCTTGTGTTGGTGTGGGTTTCCTCCGGGTTTCCCCCA
CAATCCAAACACATTCGCTATAGGGGAATTGAGTTAACAA
AATTAGCCGTAGTGTGTGTGAATGAGAGTGAATAGATGTT
TCCCAGTACTGGGTTGCGGCTGGAAGGGCATCCGCTGTGT
AAAACATATTCTGGAATAGTTGACATTTCATTCTGCTTTG
GCGACCTCTGAAATAGAGACTAAGCTGAAGGAAAATGACT
GAATGGATGAATATTGGGGGAGATCAGCCATTGACTTTCA
TAGTATTTGTTTTGTTCTTACTATGGATGTCAGTGGCTGC
TCTTATTTATCTTTTGTGTTCTTTACAGAAGAAAGAAATT
CTTATATGTTTAGAACCACATGAGTAAATATGAGGAAATT
TCATTTTTGGGGGTTGAGCTGTCTCTTAAAACATAATTTT
ATGGCTTTGTGTATTACTGTAGTGAGTTACTTTTTTCATT
CTTGTGATGATAATGGGGTTTTTTAATGGCACATGGTGTT
TCAAAAAAACTACCTTTTCATTACCGTAATGCTAAAAGAA
ACAATGTTATATGTTATTATACTGTACTTTTGCAGTCATA
TGTGCTGCTGATATTTGTTATTAACAATGTTTTTTTTTTT
CATTTTTTAAAGCGAGGTTGATTTTCAATACGTTTAATTA
ATGTCAGGATTTATTTTATTTTTAAGCATTACAGTAATGA
CTGATTGATTTCATTCTGGTAGTGTTTCTTTTTACAGTAA
TGAAATATTTTTATTCTGGTAGGGTTTTTTAGTATTACGG
TAATGACTTTGTCATCTTTCTGGTGGAGTTTTTTTTTTAG
GAAATTAGTATTTTTTTTCATTATGGTAATGACTTATTGT
CATCTTTCTGGTAATGTTTTTTTCATTTACGGTAAGGACT
TTCTCATTCTGGTAGTGTTTTTTTCATTATGGTAATGACT
TTCTAATTCTGGTAGTGTTTTTTTTTTCATTACGGTAATG
ACTTCTCATTCTGGTAGTGTGTTTTTTTTTCATTACGGTA
ATGACTTTTTCTCATTCTGGTAGTGTTTTTTTTCATTACT
GTAATGACTTATTGTTAACTTTCTGGTAGTTTTTTTTTCA
TTACGGTAATGACTTTTTCTCATTCTGGTAGTGTTTTTTT
TCTTTATGAAAATGAGTCATTCTGATATTGTTTTTTTTTC
ATTACGGTAATGACTTTTCATTCTGGTAGTGTTTTTTTAT
TACGGTAATGACTTATTGTCATGTTTTTGGTAGTGTTTTT
TCATTACGGTAATGACTTTTTCTCATTCTGGTAGTGTTTA
TTTTCATTACGGTAATGACTTTTTCTCATTCTGATAGTGT
TTTTTTTTAATTACTGTAATGACTCATTGTCAACTTTCTG
GTAGTTTCTTTCATTACGGTAATGTCTTATTGTTTTCAAT
TTGGTAGTGTTTTTTATTACAGCAGGGGTGTCCACACTAG
GTCCTGGAGGGCCAGTGTCCTGGAAAATTTAGCTCCAACC
CTAATCAAACACACCTGAACCAGCTAATCAAACTGTATTA
CGGTAATGACTCATTCTGGTAGTGTTTTTTTTTTCATTAC
GGAAATTTTCATTCTGGTAGTGTTTTTTATTACCGTAATA
ACTTATTGTTTTCATTCTAGTAGTGTTTTTTTCATTACCG
TAATAACGTATCGTTTTCTTTTTGGTAGTTTTTTTTGTTT
TTTCATTACAGTAATGACTTATTGTTTTTTTTCAAGTAGT
GTTTTTTTTATTATGGTAATGACTTATCGTTTTAAATTCA
GTAGTGTTTTTTCATTACGGTAATGACTTTTTTTCAATGA
AATATTTTTGTTTTGGTAGTTTCTTTTCAGCATTACAGTA
AAGAATTATTGTTTTCATTCTCATAGTGATTTTTTTTTTG
CATTACAGTAATTGTTTCCATTCTGGTAGTCATAGTGAAT
TATTTTCATTCTGGTAATGATTTTATTTTATATATTGAAA
AAAGATTCATCCAAAAACTCCACCAGTACTATAGAATTTT
GTGTGTGTGTGTTTTGAATGTAAATGTTTCACAAAGCTAA
TTTTTGTCTGTCAGACTGATCTCAAACAGTGTGCTCAAGC
AAATCACGCTGTTTGTAATTAATACTTCATGTTGAGCTCC
TGATTTTTGGATTTGTGTGTTTGGAATAATGAGGTGTATG
TTCTGTGTGTGAGTTGTTCGCACCTACAACAAGTCAAATG
TCTTTTTGATGTAAATCACTAACAAGTAAAGCGTTTGTTA
CTTGATGCAAACTAAATGGGAGCGTGTATTTGCACACGCA
AGTGCATAAATGTACGTAAAAGCAAGACGCTTTGTTTTTT
TAGTTTTAGTCAATTCTCACTTCACAGACTACTTATTTTT
CCATTTGGACAGCTTATTTCAAGTGAGTGAAATATATGTT
TAATGGAAAATATAAGTTATGAACTCAAGGTCGCTGAAAT
GAACACTCTTTTATGGACGTTGTTGTTATTATTCAGACTT
TTGTAGCATATGCACACTTCTTTTTCCTAAATGGAAATGC
AACAAAAAGCCCAAAACAAATGACAATCAGGCATTTCATA
CAAAGGATGTTTTGGCACAACATAAGCCTCAAGTGTAAGT
GTTGTGCTTAAAAAAATAATGCAAAGACGAGTAAAAAAAA
ACTAAACAGATCCCAGTTTCCATCACCAGCACCGAAAAAA
TCAGCCGGAGGTTTTCCATCATCCAGGTCAATGTTCTTTC
ACTGTACAGTCTTTGTTTTTGAATTTAATTCCAGGGTTTC
ATCGGCACAGACAATCCTGTGAACGTCTGTTTGCGTTATT
TTTGTGTGTATGTGTGTGTGTGTGTGTGAACTGTAAAAGT
TGGCATGAATGTTTTGCAGATGTGTGGTTGCATGTTTTAC
TCTTTTTGAGCATGCAGAGAGGACTCTCTTCTCTTCTGCT
GATGTTACTTCATTTCTGCTATGCTTACAGACTGAGCTTT
GATACACCGGTACATCCCAATCCTCTTCCTAGCTCTCATT
TGCAGACGTTTGTTTTATTTAATAATTATAATAGCAATGA
AAAAAGTAGACAATTCTAGATAGACTTTATGGTGCAATGA
GGAGAAAATAAAAAGCATCATGAATTGTTTTCTGTAGAGT
GCAGCAGTTGGTGAATTTGTCGATTCTTGGTTGTTATTTT
TTTAATGTCATGTACTGCTTTTTTCGTCAGAGGGCTTTTG
TTTTTCTTTATTCTGAAGTAGATGTACATCTAATCAAATG
CCAAATAAATTGTACAAATGAAGCACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dgcr2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028645 (1),  Ensembl_Trans:ENSDART00000063071 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC076492 (1) 2650 bp
GenBank:CT619904 (1) 814 bp
GenBank:CK018609 (1) 794 bp
GenBank:CT608980 (1) 786 bp
GenBank:CT720324 (1) 703 bp
GenBank:CT631708 (1) 623 bp
GenBank:AL918008 (1) 539 bp
GenBank:EB890260 (1) 529 bp
CITATIONS (2)