ZFIN ID: ZDB-TSCRIPT-090929-11083
Transcript Name: plcxd3-201
Previous Name: plcxd3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028604 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028604|OTTDARG00000022258|ZDB-GENE-050327-10 plcxd3|OTTDARP00000023388 DKEY-250L23.1-001 LG_ BX571721.8 Danio rerio protein_coding KNOWN, 2378 bp
GCTCGCGCTGTGAACTCACGCGAGCGCGGCGCTGAAGACT
CAAGCACTCAGAGCGAGCGCGGACACCGAGCACCGGAGAA
CCGACAGCATGGCCTCGTCTCAGGGGAAGAGCGAACTCCG
TTATGCGGACTGGATGTCTAGTTTACCGGACACCTTGCAC
GGTATTCCTCTTACCAACCTCGCCATTCCGGGTTCCCATG
ACTCCTTCAGTTTCTACATTGACGAAGCCTCACCAGTGGG
TCCAGAGCAACCAGAAACAGTGCAGAACTTTGTGTCTGTG
TTTGGCACTGTGGCTAAGAAGCTGATGAGGAAGTGGTTGG
CAACACAAACCATGAACTTCACCAGCCAGCTGGAGGCAGG
CATCCGCTTCTTTGACCTCCGCATATCCACCAAACCCAGA
GACCCCGACAACGAGCTCTACTTTGCACATGGCCTGTTCA
GCGCCACAGTACGTGAAGGCCTGGAGCAGATCAGCACCTT
CCTGGCCTCTCATGCCCGCGAGGTTGTGTTCCTGGACTTC
AACCACTTCTATGGTGTACAGAACCTCCATCACGAGAAGC
TGGTGCAGATGCTACGCACCGTCTTCGGAGACCGACTCTG
TCCAGTAGTGTTTGCTCAAGAAGTCAGCCTGAAATACCTC
TGGGAGAAAGAGTACCAGGTGCTGGTCTTCTATCACAATC
CAATGGCTCTGGAGGTTCCTTTCCTGTGGCCAGGTCAGAT
GATGCCTGCTCCTTGGGCCAACACCACAGATCCTGAGAAG
CTCATTCTGTTCCTTCAAGCTTCAGTAAAGGATCGGAGAC
GTAAGGGCACCTTTTTTGTGTCCCAGGTGGTTCTTACTCC
AAAAGCAAGCACCGTCATGAAGGGAGTCACCAGTGGTTTA
AGGGAGACCATTACAGAGAGGGCTCTTCCTAGCATGATGC
AGTGGATCCGCTCACAGCGGCCTGGGGAAAGTGGAGTAAA
CATCATCACTGCCGATTTCGTGGAGCTGGGGGAATTTATC
AGCGCTGTTATCACCCTCAACTACTACTTGGATGATGAGG
AAGAGAACGCCACCTGAACCTCCACATATACCGTGGTATC
GATTACTTGCTCCCTCTCTCTTTGCCATATTTTTTTAAAT
GTCTTATTGATTTTAATAATTTTTTCGGATCATAGAAACT
CTGTTCAACTCTGATATATTTAGGGCTAATGAAAAGCATA
AGAATGAGAGTAGAGGCCAGACACGGTCAGATAGAATCAT
TTTAGGTTTTGTCTGAGAATGAATGGGGGCAGATGATAAC
ATAATTTCGAAGGGGAAAAAAAGGTGACCAGCCTTTTCCT
GTTTCTCTGCTTCCCATCTGTTGGACTACTAGTTGCTGAT
TCACATGCTCAAAACCTTCTGATCTAACAGTTCTCATTTC
AAGGAAATAAATATTGTTTGTACAGTGAATGTGATGCTGA
ATCTATAGTAGGTTTACTTCTAGTGGTCGTAGTAACTTGT
ATGATTGTCAAATTGTAAATACTTGTAAACCTGTTGAATT
GTAACTTTGCTCATCTCACTATTTGTCATGCCCGAAAAAA
AAGAAAACATATGTCAAGGTTTCCTTTGGGTGCCTTGGTC
TGGTCTTACAATGTTGATGAAGTGAACTATTAGATGTTTG
TATTCACAACCAAAAACTGCAAATGTATGTAACAGCATTT
TTGCCTTTCAACACTACTAATTAAGGCTTTGTATCAACTT
TTTTGTAGTCGTCCTTTACTTTATCCTACAGATTATTTTA
TACATATCTGGGAATGACATAAATATTCATTTAATTTGCA
CTGCTGTGACTGTGGACTGTTAAAAGTGGCCATCCGAGTT
TGCCAATGCATAAAATCCCTTAATAATGCATCATTTGCAT
TCAACTGTAAACATGCATACATAAACGAACACACAGGGGA
CGAACTCAATGGGTGTGAACAGACTTATTATAACACCATT
TTCTAATTAGCCCGACTAATTGGATAAATGGCCTTGCGGA
TGTTTTAATCACACAGACGCCAGGAAATTAAATTTGTTTA
AAATCTGACATTATAAAACAATATGTCACGTTGCTGCTTT
CTTCTTTTGTCTGTCCTGTTGAGATTAGTCTTAAATTGAC
TGGAAATTTAAGGTTACGTGGCCCTAGAATTTCAACTTGG
AAAGTGTTTGATTCATGTTCAATAATTTGACAATCCCATG
GCCGACCTGGAGCATGGACTTGTGTGAATGCATTAATCAT
GCCTTTGTACAGTACAAATTTGCATGTAGTCGTCAAAGTC
GATAAATTGTACGTAAACTTTCTATGGTTATATGTCCTAA
TCGAGAATTTCTGACAAATCTGGTGTACAATAAATGTAAA
TACTGCATATACAATGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
plcxd3-201 Contained in:
OTHER plcxd3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028604 (1)
  • Ensembl_Trans:ENSDART00000077053 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091866 (1) 2340bp
    GenBank:BI427964 (1) 640bp
    GenBank:BI982261 (1) 609bp
    GenBank:BM186719 (1) 594bp
    GenBank:BI350795 (1) 547bp
    GenBank:BM186281 (1) 441bp
    GenBank:BI982042 (1) 440bp
    GenBank:BI428230 (1) 384bp
    GenBank:BI710305 (1) 383bp
    GenBank:AW233521 (1) 307bp
    CITATIONS (2)