header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11061
Transcript Name: mpeg1.1-201
Previous Names: mpeg1-001, mpeg1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028575 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028575|OTTDARG00000022241|ZDB-GENE-030131-7347 mpeg1.1|OTTDARP00000023362 CH211-103N10.1-001 LG_ AL928845.10 Danio rerio protein_coding KNOWN, 2634 bp
ATTAGTGCAGGAGACAGCAAAACACCCATCTGGCGATCAT
GAAGTCAAGAGCATTTCACCTGCTGATGCTCTGCTGTTTT
ATCAGTGTCTGCAACCTGCATCCACTTATTCGTCCTAATA
ATGGACTGCGATTGTGCCGCAAAAACTCAAGTTTGACAGC
ACTGGAGGTTCTACCAGGCGGAGGATGGGATAACCTGCGC
AACATAGACATGGGCAGAGTGATGAATCTGAGCTATTCTC
AGTGTCAGACCACAGAAGATGGAGTCTATCTCATTCCAGA
TGAAGTCTTTGTCATTCCACAAAAAGTGAGCGGAGTGGAG
ACAAACTCAGAGATCATCATGTCGTGGCTGGAACAGAAAA
GCTCAACTTCAAGCTCCGTTAATGCTGATGTTTCCTTCTT
CTCAGTACTCAATGCAAAATTCTCCACAGAAAACCAGCGC
ATGAAGACCCACCAAGTGAAAGAGGGTTCTGTTACAGCAC
GGGTTCAAGTCCGTAACCATCTGTACACAGTAAAGGCGTA
TCCTGACTTCACTCTGGACTCCCGCTTTGCAAAACAGGCA
GAAGAAATCGCTGACGCCATTGAAAACAATCAAACACGTC
ATGCTAATTATTTGTCAGAGAAACTCGTACTTGATTACGG
CACCCATGTCATCACAAGTGTTGATGCTGGAGCCACATTG
GTGCAAGAAGATTATTTAAAAATGTCTTATATCTCCAACA
GTCAGTCAGACAAGTCTTCTGTTTCAGCATCAGCCGGCGC
TAACTTCTTTGACAAAGTTAAATTTGATATTGGTGGGAAT
ACCTCCCAAGGCAGCTCTCAAAGCAGTAGTTATCAGGGCA
ACATCACCTATTCTTTAATTCAGAGCCACGGAGGAGCTTT
ATTCTACCCAGGCATCACTCTGCAGAAGTGGCAACAAAGT
ACGCTCAATAATCTGGTGGCAATTGACCGCTCTGGGCTGC
CGCTGCACTATTTTCTTAATCCATCAACATTCCCAGACCT
CCCAACACCAACAGTGAACAAATTGGCTTCAACAGTGCGT
AAAGCAGCAGAGCGTTACTATAAAGTGAACACCATTCCAG
GTTGTGTAAATGTGGATTCCCCAAACTTCAACTTTCAGGC
AAATGTAGACGATGCATCTTGTGAGGGTCCGATCACCAAT
CTTAGCTTTGGTGGCATTTACCAAAGATGCACTCCACTGA
CTCCAGATGGAAACATCATCTGTGATGAAACAGCACAGAA
AAACCCAGCCACCGGTGGTTATTCTTGCCCTCAACATTAC
AACACCACCTTGTTACACTCTGAGATAGTGGAAAAAGGCT
TTAATCATTATGAATGCCACACCCACTGCCATTCCTGTGG
TTTCTTAGGGTTGTCTACTTGTTGTGACAAAACATGTGGT
GATTCTTACCACGTCCGTCGTGCTAAACTTGAAACGCTCT
GGTGCTCTTCAACACATAAAACCCCTGAGAACTCTGGATA
TCTCTTTGGAGGTCTGTTTGGACCAGGCATCCAAAACCCA
TTGACCAAATCCAGCAGTTGTCCTCCAAGTTACTTCACCC
AACGCTTCTTGTCTAATGGCATGATGATTTGTATGAGCAA
TGATTATGAGATTGGAACAAGATTCTCAGTGCCATTTGCT
GGGTTTTTCAGTTGTCAATCTGGCAACCCTCTTTCAAATG
GTCAATCTCGCTGTCCGCCTCAGTTCAGCCAACATCTCGC
TGCCATCAGTGATGGCTGTCAGGTTTTGTACTGTGTCCAG
TCTGGTGTGTTCAGTGGTGGTCATTTAAAACCAGTTCGTC
TTCCACCGTTCACAAGACCACCAGTGGTCGGCATGATTGC
GACAAACACAGTGGCTGTAATGACAGAAGGTGAGCGTTCT
TGGGTGAGAGTTGGAGAGACTAAAATGTGGCGATTGGCAA
AGCCTGGTGACATTAAACAAATGCAATCAATACTCGATGC
CTCTGAGATGTCTGGAGGAAAAAAGGCTGGAGTAGCCATT
GGTATAATAGTCCTGGTTGCTCTCGTTGTCGCAGGCACTG
TGGTTATAATGAAAAGAAGAAATAGGTTCTCTAGTCTAAA
GCTGAACAGAGGTTATGAAGAGATTAGTGAGGGACGAAAT
GAGAGCAGTGTTGAGATTGAACAAGAGCAGAATGAAGCTG
CAAATGAAAACCCCAATCAACAACTACTCTCATAACAGTC
GTTTTAAGATCAACGTCCAGAGACTTATAGTTAAACTTCA
TAACATTTTAATGAATATTAGAAGTATAGTGATTACTAAA
AGTTGTCTGAATTGTCTAAATGTTGTCTTGCTTTACAACC
AACAGTTGAAACAAAGAAAAAAAAAATGTTTCTATTAAAT
GTCTCTGTCATTATAAAAATATAAAAATGATTTAGTTAAA
TATGAGGAAAGACTGTATAAAGTATGTTTTACTACATACG
TGTAAGTGTTATATATTTTTTGTTTTGAAACAAGTGTTCA
TTACTCTGAAATGAATTAGTTTTGGGGAATCTATGAATTA
TAGGTTTAAACGCAAAATTATTTTCAATGGATTTATACTT
TTTTTCCCCAAATTTATGTAGATCGGTGTGCTTTTTCTGA
CTAATAAAGAGTTCTTGAGCATACACAAGGACAT

mpeg1.1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mpeg1.1-201 2634
mpeg1.1-202 (1) 820
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mpeg1.1-201 Contained in:
OTHER mpeg1.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028575 (1)
  • Ensembl_Trans:ENSDART00000077637 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055644 (1) 2638bp
    GenBank:AI385039 (1) 317bp
    CITATIONS (2)