header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11046
Transcript Name: pknox2-201
Previous Name: pknox2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028560 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028560|OTTDARG00000022230|ZDB-GENE-031118-112 pknox2|OTTDARP00000023349 CH211-123N8.1-001 LG_none CR925737.8,CU062503.6,BX950197.23,BX897743.8 Danio rerio protein_coding KNOWN, 2611 bp
GTCAGCCTGGTGTCAGTCTGATGAAGATTGGCATTCAGAC
TGTGTGGAGGGCAGCGCGCCGGCGGACAGACTCCAACATC
AGATGCGCTGATGCTGAGAACAAGCAAACTGGTCTCCATG
TGAAGCTATCCCATGATGCAACATGTGTCCCCAGCACCAG
CATTGACCATGATGGCCACACAGAGCGTCCCTCCACCATC
ATACCAGGAGAGCCAACAGATGACAGGCACTACTCAGCAA
AACTCAAAGGGCCAGCATGTGCACCTCTCTGCAGCGTCAG
CAGGAGGAGCCGCTCCGGTCAGCGTGACTCTTGACCCTCA
AGCCCAACTGGAGTCTGACAAACGAGCCGTTTACAGGCAT
CCTCTTTTTCCTCTTCTGGCGTTGCTGTTTGAGAAGTGTG
AACAAGCCACGCAGGGCTCAGAATGCATCACATCCGCCAG
CTTCGACGTCGACATCGAAAACTTTGTCCACCAGCAAGAG
CAGGACCACAAGCCTTTCTTCAGCGAGGATCCTGAACTAG
ACAACCTGATGGTGAAGGCCATCCAGGTGTTGCGGATCCA
CCTGCTGGAGCTGGAGAAGGTGAACGAGCTCTGTAAAGAC
TTCTGCAACCGCTACATCACCTGCCTCAAGACCAAGATGC
ACAGTGACAATCTGCTCCGAAACGACCTGGGCGGCCCGTA
TTCTCCATCCCAGACCAGCCTCGGCCTGCAGCAGGACCTG
CTTCAAAGCTCATCCCCATCGCTCACCTCCGTCTCCAGCA
CAGTGAACTCCTCCGGGATCGTAGTCCCAGCCGGTCCCCT
GCAGCAGAACAACATCTCCATGACCACTATCAACTCTCAG
GTGGTCTCAGGTGGGACGCTGTATCAGCCGGTGGCAATGG
TTACCTCACAGGGGCAGGTGTTAACACAGGGGTTACCACA
GGGAACCATCCAGATCCAAAACAATCAGGTGAATCTGGAC
TTGTCCTCACTCTTGGATGGCGATGACAAGAAATCAAAAA
ACAAAAGAGGCGTCCTTCCCAAACATGCCACAAACATTAT
GCGTTCCTGGCTCTTCCAGCATCTCATGCACCCTTATCCA
ACAGAAGATGAGAAAAGACAGATTGCAGCGCAAACAAACC
TTACCTTATTACAGGTGAACAACTGGTTTATCAATGCCCG
CAGGCGTATTCTGCAGCCCATGCTGGATGCCAGTAATCCT
GACCCTGCTCCCAAAGCCAAGAAGATGAAATCTCAGCACA
GACCCACACAGCGCTTCTGGCCCGATTCCATTGTAGCTGG
AGTCCTGCAGACACACGGCACAAACAACTCAGACAACTCT
CTTGGCATGGACGGCCTGCAGCCTCTGTCCTCAGACTCGG
CTACGCTGGCCATGCAGCAGGCCATGCTGGGCGGAACCGA
CGACTCCATGGACGGCACAGAGGAGGAGGACGAGGAGGAG
GAGGAAGACGAGGGACTCGATGAGGACGACGACGAAGAGG
ACGACGAAGAACACGAGGCGAGCAGACAGATGATCAGGCG
AGATCTGGGCCTCAATCACAATGAAGGACTCGAATAAAGA
ATGAAAAATAGCATAACTGACTTAACTCTTACTCATCACC
ATGCAAAACATCTCAACGCCGCACAAATGGCTCTCATTGG
ACACTAAGTGCCATGGAGCACCCAATCATAATGAAGGGGA
GGGGCCTACCATTCTGGACTCCAAAATTGATGGAACATTG
TATATTGGGCCGCTTTACGCAACCGGTCATGCTACTCTCA
TGCATATAATCCATTTAAGCCTTACTTTCTTTAAATATGT
CTCTTTGGTTCTCAGGTGTCTTAGCATGACATTATGTCTA
CCCTCATATTTATAACCATGCAATGAGTGGATGTTTTAGG
CATGTTTTTTTATTATTATTATTATTAGTTTCATTTTTTG
TAGAGTTAACAAAATATTCAGTCTTGGAAGTTAAACAAAC
AGAAAAAAAGAAACAATCTAAATGCCTGACAGCACAATGT
ATGTACATTTGACAGTGATGCATTTTCCCCCCCTCAGACG
CTTCATATTTATTTTGTAATCTGTCAGAAGGCTGTGGCAC
AATCAACAAAGGATGCCGTCCGCAAACGCATGTCGGGAGA
CTCAGAGTGCCAAGCATCTCTTCCATAGCGAGGAACAAAA
AACTCTCTCCGAAATATGTTTGGACCTACAAATGACGTTT
ACTGAAGAACACTGCAGGAAAAACAAAAAGACATATTTAC
AGGTGCGTATCACACCCTGAAACGCCCCTGCTTTATTTTA
TGTGAAGGACGAAACTAAACAAAAAAAAAAAAACTGTGAA
GATATTTCTGAGCTGTATCTACGGATCTACAGAATCACCT
GTTTCTGATATGTGATGTTTAGAGAAGACAGAGGATGTTT
CTGAATGTTATTACAGTTGGTCTTTGTGAAGTACATGTTT
CTCATTATCCTTTTCTTGGTTGTTGTTCTTTTTTTTAAAT
GGTTCTTCCAGAGCAAGTGATGATAGGGGAGCTTTTTAAT
TATTTGTTTGTATACATTGTTGTCATAATCTATTGTGTTT
CAGTAGACCATTTTGATAATTAAAAACGTTGAAACTTTAA
AAACTTAAAAA

pknox2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pknox2-002 (1) 680
mRNA pknox2-201 2611
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pknox2-201 Contained in:

OTHER pknox2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028560 (1)
  • Ensembl_Trans:ENSDART00000134866 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC117639 (1) 2586 bp
    GenBank:EE323780 (1) 828 bp
    CITATIONS (2)