header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10967
Transcript Name: got2b-201
Previous Name: got2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028476 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028476|OTTDARG00000022175|ZDB-GENE-030131-7917 got2b|OTTDARP00000023278 CH211-122F10.1-001 LG_none CU633476.8,BX957362.26 Danio rerio protein_coding KNOWN, 1708 bp
GCCGCTAGATAGAGCTGTCTCCTGGCTTTTCTCTTCATGA
ACGCGCACTCTTGCGCGCTGACAGACTCGTGCTCGCTCCC
AGTCTGTGCTTCAGCCGACAGCAGCAGCAGCAAGCAGCAG
CGATGGCTCTCCTCAAAACCACCAAGTTCATCTCTTCTGT
TGGGAGTTTGACTCCTTCGTTGGCTAGCCTACCTATTAGA
GCCAGCTCATGGTGGACTGAGGTGCAGATGGGACCCCCTG
ATCCCATCCTGGGGGTGACTGAGGCCTTCAAACGGGACAC
AAACTCAAAGAAAATGAACCTTGGTGTGGGGGCATACAGG
GATGACAATGGCAAGCCATACGTTCTCAACTGTGTCCGCA
AGGCTGAGTCTCTGATTGCCTCTAAGGCGCTGGATAAAGA
GTATCTAGGCATTGTGGGTCTGGGGGATTTCAATAAGGCT
TGTGCTGAGCTTGCACTGGGGCAGGACAGTGATGTTCTCA
AAAGCAAGAGGAGCATTACTGTCCAGACAATCTCAGGCAC
TGGTTCTTTGAGGGTTGGAGCCAATTTCCTGTCACGCTTC
CACACAGTTGCGAGGGATGTGTACTTGCCGAAGCCATCCT
GGGGAAATCACACACCTATTTTCCGTGATGCTGGTATGCA
ACTGAAAGCGTACCGCTACTATGATCCTGCTACTTGTGGC
TTTGACTTCACTGGAGCGCTTGATGACATCTCTAAAATTC
CACAGAATAGTGTAATCCTGCTCCATGCTTGTGCTCATAA
CCCCACTGGTGTTGACCCACGACCAGAGCAGTGGAAGGAG
CTGTCAGCCGTCATTAAGGAGAGGAAACTTCTGCCGTTCT
TTGACATGGCCTACCAGGGCTTTGCTAGTGGAGACATTGA
TCGGGATGCCTGGGCTGTGAGATACTTCATCGAGCAGGGC
CACAACATTCTCCTGTCACAGTCTTTTGCCAAGAACATGG
GTCTCTATGGTGAGCGTGTTGGAGGATTCACAGTGGTGTG
TGGAGATGCTGAAGAGGCTAAAAGAGTCGAGTCTCAGCTT
AAGATTCTGATTTGCCCCATTTACTCCAACCCTCCCATGA
ATGGTGCCCGCATCGCCTCCACGATCCTCACTACACCAGA
GCTGCGTTCTACATGGCTGGAGGAGGTGAAGGGAATGGCA
GACCGTATCATTAGAATGAGAGAAATGCTGGTGACTAATC
TGAAGAAGGAGGGCTCCACTCACAACTGGCAACACGTGAC
TGACCAAATCGGCATGTTCTGCTTTACTGGACTCAAACCT
GAGCAGGTGGAGCGTCTGACAAAGGACTTCTCTGTTTACA
TGACTAAAGATGGCCGTATCAGCGTTGCCGGCGTGACCTC
TGGAAATGTTGAATACCTCGCACATGCCATTCACCAGGTC
ACCAAGTAGACCAAATTTGCTATGATGGAAGATTTAACTT
CTAGACCTGCTTAGTCCACCCCAATATTCCTCTTTGGACT
CAGATCTCGGCTTCACTTCATTTGGCTGTTTCACTAGGTC
AACGTGGATCCCTAACATGGATGCTTTCAGGGTGTCTAAC
GGGAGTCGTCTCGCAGGCTATCCTGTGGTTCAGTGACTAA
TAAGCACACTTCAGAACATTTTTCATCCTGTTAAACTCTG
TATGAACTTTATTTATTGTGTGAGTGAAGTAAAATGAGCA
ACAGTAATAAACAGTATTGTGTCCATTT

got2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA got2b-002 (1) 800
mRNA got2b-201 1708
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
got2b-201 Contained in:
OTHER got2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028476 (1)
  • Ensembl_Trans:ENSDART00000007767 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC049435 (1) 1670bp
    GenBank:CK695689 (1) 405bp
    CITATIONS (2)