ZFIN ID: ZDB-TSCRIPT-090929-10746
Transcript Name: zgc:77517-201
Previous Name: zgc:77517-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028235 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028235|OTTDARG00000022018|ZDB-GENE-040426-1508 zgc:77517|OTTDARP00000023092 DKEY-195M11.4-001 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 1827 bp
AAAAGAGAAAAGGAGGAACAGAAAGAGTTTGGTGGGGGTA
TAAAAGCTGTACAGTTCTCTTCTAGTGGCTCTCAAGGGTT
GACATCCCTCAGCGCACACTCATCTTCTACTGCAGCCAGA
GCTTCATTCCTCCAAAACCATGAGCTTCTACGCACCCCAG
GCCTCTCACATCTCCTTCACCCGCTCTGCGCCCGCTTACC
GGGCTGCCAGTACGTATGGTGGGGCAGGTGGGCAAGGCAC
CAGAATCTCATCCGCTTCTGCGATGTCTTATCGTTCAGCC
CCTAGAAGTGGGGGAATTTCCTCTTCCACAGCCTTCAAGG
TGAGCTCAGCCGGCATGGGCTCTGGCGCAGGGGGTTCCTT
CTTGGCGAGCTCTGGGTCCTCAGGTGGCATGCTGGGCAAT
GAGAAAGGCCAGATGCAGAATTTAAACGACCGTCTGGCTG
CTTACCTGGACACAGTGCGCAGGTTGGAGCAGGAGAACGG
CAAACTGGAACAGCAGATTCGAGAGGCTCTGGAGAAAGGT
GGACCAGAAACACGCGACTACAGCAAGTACAACGCCATCC
TGGATGACCTGAGGAGGAAGGTGTTTGATGCCACTGTGGA
CAATGCTCGTCTTGTTCTGCAGATTGACAACGCTCGTCTG
GCTGTGGATGACTTCAGAGTCAAGTTTGAGAATGAGATGG
CAATCAGGCAGTCTGTGGAAGGAGACATCGCAGGTCTAAA
GAAAGTTATAGATGAAACCAATATTGGTCGCCTGAATGTG
GAGGGAGAAATCGAGTCCTTGAAAGAAGAGCTTGTCTTCC
TCAAGAAAAACCATGAAAATGAAGTTGATGAGCTACGGAG
CCAGATCTCTCAGTCAGGCGTTCAGGTGGATGTTGATGCA
CCCAAGGGCCAGGATATGTCTCAAGTGATGGAAGACATGA
GAGCTAACTATGAGAAACAGGCTCTCAAAAATGCAGAGGA
ACTCAAAATGTGGCATGAAACCCAGATAGCAGATGTTCAG
GTGCAGGTGGCTCAGAACACAGAGGCATTACAAGGTGCTC
AGATGGAGTGTAATGACCTACGCCGACAGATTCAAACACT
AGAAATAGAGCTTGCATCACAACAAAACCTGAAAGCGTCA
CTTGAAGATACTCTACGAAACACTGAGATACGTTCAAATG
GAGAGATGGAGAAGTTAAATAACATCATAATTCAACTTGA
AGCTGAGCTGGCACAGCTGAGGGCAAATATCACAGAACAG
GGACAGGAATATGAAGCACTCCTTAATATGAAGATGAAAC
TGGAAGCGGAAATTAACACCTACAAGAAACTTCTAGATGG
GGAAGATTTCAAGCTCCAGGATGCGCTTGATGGCTGAGAA
AAAAAGAGTGAAATTACAGGAGACGGTCCTAAAGATCAAC
AACAACTTCAAGACAATTATAAATTGCATTCAATGAAACC
TGTGGTGAAGCTTTATAATTTGAAAGTCTCCTTCCACTTT
GTTTAAACTATACAATTTACAGAGCCATGTTGGTTTCTGG
CCATATTTCTTCTCTTCATTATAATGTCATTTACAGGGTA
TTTGCTTTCTGTCAATGAACCCTGTTTCACCCTACAGTCT
GACTTAAAGACAGTTACAGGGCAACATAGGCAGCTTTTTA
AATGTTTGGTTGTGTATTGAGTCTTTATAATGCACAATCC
TGTATTGTAGCAGTGTAAAACGGATATCTCCAAATGAAAG
AGGAATGAGAAAATGTGAACCTCTCTACAAAACCAAAGCA
ATAATGAAATAAATCCATGCCTGCCAACAGAAAAAAAAAT
GAGTAAAGCAAACACAGAGATCTGAAA

krt18b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA zgc:77517-201 1827
zgc:77517-202 (1) 1302
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:77517-201 Contained in:
OTHER zgc:77517-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028235 (1)
  • Ensembl_Trans:ENSDART00000028260 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056584 (1) 1742bp
    GenBank:BC066541 (1) 1383bp
    GenBank:CK028251 (1) 1106bp
    GenBank:EG571813 (1) 921bp
    GenBank:CK707082 (1) 815bp
    GenBank:DV595309 (1) 807bp
    GenBank:CO796153 (1) 798bp
    GenBank:EE214097 (1) 510bp
    GenBank:BI846469 (1) 319bp
    CITATIONS (2)