Transcript

sox14-201

ID
ZDB-TSCRIPT-090929-10702
Name
sox14-201
Previous Names
  • sox14-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028188 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028188|OTTDARG00000021986|ZDB-GENE-051113-268 sox14|OTTDARP00000023056 sox14-001 LG_ BX465208.18 Danio rerio protein_coding KNOWN, 1943 bp
CTTCACCGCTTTTGGCTCTCATTCACGCGCTTCTCCTCAT
TTCCCAGCCAGGTGCTTCGCGGGGCGAGAATCCTCCGAGA
AAAAAAGCGAGCAAACAGATCGCGGAAACTTCGCTTCCCG
TGCTGGATTTTGTGGCGCGCGTGGCTGTTCTTCTCTCAGC
CGAATAGTGTCGTTTTGAAGAGTCGTCATAATTCAACTAA
ACGACAAACACGGAAGAATTACTGGATTTTTTTCATCTCT
TCTCTCTCATTGATGCCGCTTTCCTGCTCCTCCGGCTCTC
TAGAACTGGCATGATCCGAGTCTGTCTGCAGGACAGGTGA
ATACCATTATCTCTTCGTTGCTTGAAGAACTTTTTTGTTG
TTATTTTAGTAGGGAAATTTTAAACGGACGCCGTGAACAT
GTCAAAACCGGCAGATCACATCAAGAGACCCATGAACGCC
TTCATGGTCTGGTCAAGAGGCCAGAGAAGGAAAATGGCTC
AAGAGAATCCCAAAATGCACAATTCCGAAATAAGCAAAAG
ACTCGGCGCCGAGTGGAAGCTGCTGTCTGAATCCGAGAAG
CGACCGTACATCGACGAGGCCAAGAGGCTGAGGGCTCAGC
ACATGAAAGAACACCCAGACTACAAATACAGACCCAGGCG
CAAACCCAAGAACCTCCTCAAGAAGGACAGGTACGTGTTT
CCTCTGCCCTACCTGGGCGACACGGATCACCTGAAAGGAC
TTCCGGTCTCAGCCACGGACTCACTCTTAGGTTCTTCGGA
AAAAGCCCGTGCGTTCCTGCCACCTACATCTGCCCCTTAC
TCCTTCCTCGACCCGAGCCAGTTCAGCTCCAGCGCCATTC
AGAAGATGACAGAGATGCCCCACACGTTGGCCACCAGCAC
TTTACCTTACGCATCATCTCTGGGATACCAGAACGGTGCA
TTCGGGAGCCTGGGTTGCCCCAGCCAGCACACTCACACCC
ACCCGTCGCCAACAAACCCGGGGTACGTGGTGCCGTGTAA
CTGCACCGCATGGTCGGCGTCGAGTTTACAGCCGCCTGTT
GCCTACATACTCTTCCCAGGTATGACCAAGAGTGGGATTG
ACCCGTACTCTTCAGCACACGCCGCTGCTATGTGACTCCA
CCACAAACAAAACAAACAATCTCCTCTTTGAAAACTTGAA
TACAGCAATGCATGTACATAAGAAGAGAGGAATGATCGAG
ACATTTATACTACTGAAGCCGGTGGACACGAACTTTTTCA
CCATCTACGAGAGGTTCCTCGGATCCCAGCATGGATCTTG
GAATAGATGTAAGGCAGGTGCCCAGAACTGTAAGAAATGT
AAATGTTCAAACGTTTATTATTATGGCTACCGAATTTGGA
TGCCTTTAATTTTATTTATTATGTACAATTTGATGCTATA
ATAATGATAATTTTGTTTGAACAGTTAATATAATTGTTAT
TCTCCTCATATTATTATTATTATTATTTGAAAGACTTTGA
TTTGCACAACTAACGGTTAGAATTTTTCTTGTACAGCCTG
ATGTATTTACCATTATTTTTGGCACTCTGAAATTCAAATG
AAACTAGGGTTTCAAAGTGAGGAATTCAGCGTTTAATAGA
ATATACGGGTTATATTGTTTATCATTATAAAAACCGTCAC
CTAAAATTAGACAGTCTATTTAAAATTTCAAGTGAAAAAA
ATAATTATAATCTTTTTTTTTTCTTTTTTTTTTGGACATT
TCTTTTTCTGTGGTTCAGTGCTAGTCACTCGTTCATTTGA
TTTCAGAAACTACAAAGTTTGAAGCGAAACAGTTCATGTT
GTATTTTTTATCTGCGATGGTAACTTAAATCCTGTCATGT
TTATGGAAAGGAAAATGTATCTAAAAAAGGGTGATACCTC
GATTCTTTGTTCATTTGCAGAGCAAAGACATTTTGAATAA
AGACAATCTGTCTTAAAAATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations