ZFIN ID: ZDB-TSCRIPT-090929-10689
Transcript Name: rgs5a-202
Previous Names: rgs5-001, rgs5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028175 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028175|OTTDARG00000021979|ZDB-GENE-030131-7570 rgs5a|OTTDARP00000023044 rsg5a-001 LG_none CR385065.21,CR854912.18 Danio rerio protein_coding KNOWN, 3124 bp
CATTGTAATTGCAAGCCAAGACTTGATTGGTTCTCGTGTT
TTTGGCTTCAGGCCAACAGACTTTCTCCATATATTAAGAG
GCGAGCAGGACGACGGCTTCTAAAAGAGAGAAGAGACAAC
AACTAATGGTAGTGGACTAACTCAAGTGAACAACTCAGAA
AATGTGTAAGGGATTAGCTGCCCTGCCCCAGACATGTCTG
GAGAGGGCTAAAGAGATCAAGACTAAATTGGGAACTCTGC
TTCAGAAGCCAGAGAATTCCATCGACCTTATTATCCCCTA
CCAGGAAAAGCCTGAGAAGAAACCAGAGAAGCTTCAGAAG
GCCACACCTGAAGAAGCAGCCCAATGGCGCGAGTCCCTTG
ATAAGGTCCTCTCCAACAGCTATGGTCTGGCCACCTTCAA
GAGCTTCCTCAGATCTGAGTTCAGTGAGGAGAACATAGAG
TTCTGGGAGGCCTGTGAGGACTTCAAGAAGACCAAGAACC
CTCTGAAAATGGCCACCAAAGCTAAAAAGATTTATGAGGA
CTTCATACAGACCGGTGGGCCCAAAGAGGTGAATATCGAC
CACTTCACCAAAGACGTGACTCTGAGAAACCTGGTGGATC
TTTCTTCCTCCACCTTTGAGCTGGCACAGAGCCGCATCTA
CACCCTGATGGAAAAGGACTCGTTTGGCCGATTCCTGCGC
TCTGACCAGTACCAGGAGCTGCTCAAGTAAACCCACTCGA
CCAGCAGCAGAAAGACTTCACACATTTAACTCATTAAAAA
AAAAAAAGAAAAATACTTTGAGCATGCACTTTTTGATGTA
CAAGCTGATTAACAATACCGCATCTGTTTATTTGGCACAA
CTGAAAATGCAATGCAAGCTCACAGTAATTTGTAACTTTT
TGATTTAGGGGCTAATTTGTATTCATTTGTACAATCTCAT
TCATACATTTTAGTATGATCTGTTCATTCCACCATGAGGG
TTATGTTTAGAGCGAGGTTTTGGTTTGCCTTCCTTTAGAA
ATGTTACTTATTACTATGAATGAAATTGTATGAATTTAGC
CACTTTTCTGACAATACATAAAATAGTTATGACTCCTCGT
GAGATCGAAAAGAAAAACAAAACATAATGTTTCAGCATCT
TCCCTCAGCTGAATGAAATGGCCCACTGCTGACAAGAACA
TCTTGCCACAAACTGTTAAATGAATGTAATTCCTGCCCAG
TGCTCTGAATGTCAAGAACTTCAGTAAAAGAAGAAAAAGA
TTGGGGTTTAAGGGTTATAATACACACTGATGAAATGTAA
TCTGTCATTAGCAAGCAACTAATTTGTATGATTTAAAGTT
TTTTGAGCGCCTCAAAATCTTGACATTCTCTATTAATTCT
GTACATTGTCCTGAAAATTGGAGTCACACTCTTTTCTGAC
CCCTGTAGACTAAATAAAGACCAAAACTGGTCCCTACTTG
TAATTTATGGCTTTTCAGATTAAGAGCAGAGGTGGTTTTG
TGTAATTTTTCTTTAATGAGGACGCGCTGACCTAAGCGTC
TAAGCATCATGTTTATCAAAAGGAAGAGGCTGGGAAATGG
AAATGGGTGGGAATGAGTGTGGGCTGTTTTTTTTTTTTTT
TTTTTTTCTTGGAAACGTCTGTGTTAATATAAAAAATGCC
CAAATGGTGTACCGAAAGACGATTTGGGGAAACAACCCAC
TTAGTATTGAAAGCGTCACTATAAGTCAATGCTTACAAAA
AAGCGTGACATGTTAAGATGCGCTCCAGTCTCTGGGAACT
TGTTGTTTGGGTTACCGCTATTGAAAGTCGCTAAGATGGG
AATATCAAGTAGGAGGGAAACTATATAAAGCACTGGGCAC
ATCGTTTTTTATTCTAAAGGCAATGTTTATTCCCATGCCA
CTTTAAATCCAAAACACATTTCGATTAAGTCATGGAAACC
CAAAACATTTGAGCGAGCATTTATCACGATACATTATATA
CAGTATAAACACATTGTAAGACATATAAACTATTATTCTA
AACAAGAGTGATTACTGCAAAATGTTATTACTTTAGATTA
AGTGGCCTTAACTATTGGGTACTTGCATCAAAAAATAAAT
ACAATGTACTTACCGTGTGCATAATGTATTGCAGAACACT
TCTGGTGGGATATGGGTATAGGAACATGTTTGGTGGTATC
GGTAGGTTTAAGGCTGGTTTGAGGTCATTAAAGCTAATAA
AAAAGGTAATCACTGAAATTAATTACAGATGTAATTACAT
GCACATTTATAATCAATCATAAATACAATGTAAGAACATG
TAATTTTACAGTAAGTACATTGTAACAACTAATTAATCTC
AGTTTAAGTATACATATCAGTTAAGGCCACTTAACATAAA
GTGGGACCATGCTATTGATGTTGTCATACAGTATATTATT
TGCTCTTAGAATCATAAGTTGTTAGAAGTTTGCGAGTTAT
TGCAATATGAGCTGCATATGTAACCCACGAGTGTGATGTT
CAGTGTCAATTTGCATGTTTTTAAACTTAAAGTGTGTTGC
ACAGACACTTATACTCTTGCATGTGTCTTTATCATATTGT
GTTTAGCCATATCACTAAGTCTAATAACATTCATTCATAC
ATGAGCAGTGAAAGGTGCTTCTGGAGGTCCTTACTGATGT
CCCGCAAAACAAAATGTTAGTTCTCTGCAGGACAGGATTA
GTTTAATGTGGTTATTAATTACTGGGAATCACCAACATGA
ATAAAATGAATTACTTTGATGGGAACCTTAAGAGCAGAAG
TAGAAACTCTGTTGAGTAAAATTTGTTTATATAAAGTTAA
ATTAATTTAGAAAAAAATAATCATTCAAATATATTATAAA
ATAACATTTGTGAGATGCAAATATCATATAAAATGTATTC
AGGGTGGGGATTTGGTAAAATTGTCAGTAAGGACTGACAG
AGTACCTCACTTATATAAAAAATCTGCATCAAGTTATATA
TGCATGTATGTTTGCAGTTGATTATATAAAATCCATAACC
ACATTGAAGTTCTGAAGATTATTTATTTATGCTACTCAGA
TGTACATATAAGCCATTTTCAGCATTTGTTTTTAATTTAT
TCTTGCTTGTCTGATTGTTTCATATTCAATTTAAAAAATA
CCAA

rgs5a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rgs5a-201 (1) 284
rgs5a-202 3124
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgs5a-202 Contained in:
OTHER rgs5a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028175 (1)
  • Ensembl_Trans:ENSDART00000127612 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC054594 (1) 2765bp
    GenBank:AW826486 (1) 565bp
    GenBank:EB798125 (1) 385bp
    CITATIONS (2)