header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10642
Transcript Name: tmem18-201
Previous Names: tmem18-001, zgc:101011-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028113 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028113|OTTDARG00000021943|ZDB-GENE-040927-26 tmem18|OTTDARP00000023001 DKEY-18F23.4-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 937 bp
ATCCATCGGTGAAGCGGAGTTTCGGTCGAGAACGAAAGAG
GAAAAAGTGACGATTGCGGAAGTGTTTGTTATTGTGGTTT
AGCTGCTAGCACAGTGGCGTGTAATCAAATAATATGACAG
CATCAAACACTAAAAACGCCAGCGCAATCCCAATCGATAA
ATTCAGCAATGTTCGCATCACATCAATATGGACTTTCCTA
CAGTCTGTTGACTGGTCTGAGCCCTGGCTGATGGCTCTGC
TGGCCTTTCATGTCTTCTGTTTTGCTTTCACCCTCCTGTC
CTGCAAATACTACCGCATTCAGATCTGTCATTTTCTCCTG
ATGGTTGCGATGGTTTACAGTGCAGAATACCTGAATGAGC
TGGCAGCCATGAATTGGAGGTCTTTCTCAAAGTTCCAGTA
TTTTGACTCAAAAGGAATGTTCATATCTTTGGTATACTCT
GTCCCGCTCTTGCTCAACACTGTTATTATTGTGGCTGTTT
GGGTATGGAGGACCTTCTCAACCATGACAGAACTTAAGAT
ATTGCAATTAAAGAGAAAAGCGGCCAGAGAGAACCACAAG
AAAACACAATAGAAGGCATGAACAGAACATGCACCATTTC
CTAATGGACTAATAATAATAATGGTCAGTGGTGGAGGGCA
TGTACTGCATATGGGCTGATTATAAGGAAAACTCTTGTGG
CAGAGGGTCTTGAATGTTTATTTCAGACTGCTGATGGACA
ATTACTATACCTGCTATAGCAAAAACTCCATCAAATGCCT
GATCTGGTCAAAAACATACTGGACAAAGGCATCACCTGTA
TTGCGCAGGCATTTTGTGTATGTGTACTATAGATAGACCA
TTCCAGTGCTTAATGCTTTTTTTTCATTGATTGGAGTGTT
GGACATGAAAATGGTGTATTTATGTCAATAAATTGAATGT
TGTCATTTTTGTATAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem18-201 Contained in:
OTHER tmem18-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028113 (1)
  • Ensembl_Trans:ENSDART00000053310 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH551792 (1) 905bp
    GenBank:BC082297 (1) 900bp
    GenBank:CK689473 (1) 715bp
    CITATIONS (2)