header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10522
Transcript Name: micall2a-201
Previous Names: micall2-002, micall2a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027989 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027989|OTTDARG00000021862|ZDB-GENE-030131-5409 micall2a|OTTDARP00000022902 micall2-002 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 3588 bp
GACAATTTGAGGCTCCTCCTCCTCCATTTCCTCTGCTCCA
CAGGTGCCGCTCTGCAGGAGTAAGCAGATTTGAAGAGACG
CCGCATTTACAGCTCAACGTCCCCTTCAGTTCATTTTAAT
CTTAATTTTCGGCGGACGTTTTCTCTTTACGGCTTCGTAA
TTTTGTCGGAAAAGACCCTTTTTAGTTTCCTGTTATTAAA
AAACACTTTGCAGTGAGTAGAGAGAGCGTTTGGAGAGAAT
GGCGGCTATTAAAGCGCTCCAGCAGTGGTGTAAAATTCAG
TGCGAGGGATACCGAGATGTGGCCATCAGCAACATGAGCA
TGTCTTTCAGAGATGGACTGGCCTTCTGTGCGCTCATCCA
CAAGTTCAGACCGGATCTCATAAACTTCGAGTCTCTCTCC
AAAGACAATGTGTATTACAACAATCACTTGGCTTTTCGTG
TGGCTGAAGATCATCTGGGGATCCCTGCTCTTCTGGATGC
GGAGGATATGGTGGCCTTGCCTGTCCCAGACAGACTCAGC
ATCCTCACATATGTCTCACAATACTACAATTACTTCCATG
GCCGCTCCCCAATCGGGGGAGTAGGAGGTATCAAGCGGCA
CGCTGAGGACTCAAAGGAGGTGCCATCAGAGAAGAAGAAT
CTGCCTGTGGTTGCCAAAAACCACAATCTCAAAACAAATA
CAGAGAACCGTCCTCCTCAAAGTGAAATGCCAAAAATTAT
CAACCGTCCTCCATCTCTTAACATCCAGAAAAGTGCTCCA
GAGAAGCACGCTCTAGCCACTCCAGCTCGGCAGACTGGCA
CAGACCGGCAGAAATCTCCAGGGCCTAAATGTGTGCAAGC
GCCCGTCACACCACTCAGAGCGAGATCTCCACAACCACAC
AGAGAAGCTGAGAAGAAGTCTGTTTTGGTGGAGACCTCAA
ATAAAACGGGTACATTAAACAGTGAATGTGCCGTCTGTGG
AAATCATGTACATCTAGTCCAGAGACACCTGGTGGATGGA
AAACTCTACCACCGGAGCTGCTATAAGTGCAGTGTATGTT
ATGGCACACTGAAATCTGGAGCATATAAACTGGGATCAGA
CACTGGTTCACTCGTCTGCACTATTCACCAACATGGCCAA
AATGGCTTCAAGCCCACTGTTAAGCCTTTTAAGAGCAGCG
GCTTTACAGTTTCTGATTTGGTGGCCAAATCTGAGCGAGA
AGATCAGTCGCCTTCACAGCGCTACATCTCTGTATTATCT
GCACCCATCAAGGCTGTTCCTAGACCTGTGGAGCTTAGCC
TGGCTCAGCAGTCATGGACGTCTTCGGCTCAGAGGACTCA
AGCAGCTCGGCAGAAGTTCTTCCAGTCTTGTGCCCCAGCA
ACAGAGCTTCAGCCCAATACCAAACCACCATTAGGCCCAG
CTGAGCCCTCCAATCTGAAGGTGCAGGAGAAAGAAGGAAA
CCGTGCTCTGGCGAATGGAAATCCACTACATGAAGGAAAC
GCCAATAACAACAATGCACTGAATTCTGACCCAAGAGCAA
AAAGCCAGGTAAAAATCAGTTGCTCTTCTGCTGAAGTCTC
TACTTGGAGGCAGGAGCTACATGTGCGAGATTCAAAAGGC
AGGAGTTCATATCAGGCTGCTCCATCCAGCCCTGCTATTA
TCAGCAGCGGCGGCGGCATGAACGGCAAGGAATCGCTCTA
CCTCAGTGCCATCAGCAAGGAGAGCAGCAGACCTCCATCC
CTGCTGCAGACTACTGCCAAAGCTTCAGCCAATGATGTTC
AGAGCTACGATGCCCCGGCTGACTGGAGATCAAAGCCAAA
GGCAGCTCCAAATGGACCAAGACTCAAATCTCCTGATATT
GCCAAAGATGTTCCATTGACGTGTGGAGAAAACAAAGATT
TAAAAGTGCAGGATTCTCAAGCCTTCATGTTGAACCACTC
CAAGGGTTGTAATAATGATTGTTCTTTGGCCTCATGCGTA
TCACCCTCTACGTCCTGTCACAAACTTTCATCTCCAAAAC
AGCCTCGCTGCGGGTCAGCGACATCAAGTTACGACAATGG
AAATATATTATGTAATAACATTTTGCTCCATGAAGCAAGG
TCACCTACTACAAACACTTGCTATATCACGCCAGAGCAGA
TCTCAAAAGAACTGCAAGACATTGAAAACAACCTCAACGA
TTTGGAGAATGAAGGAGTGGAGCTGGAATGGAAACTTCGT
GTTTATGAAGAAGAGGGTCATGGGGACATTCTGATGGACC
CCTTAATGGTTGATTGGTTTAACCTGATTCGGAAGAAACA
AAGCTACATACGGAGAGAGTCGGAGTTGATGTACATAGCA
AGAACACAAGATCTGGAGGAGCAACAGCCGGGAGTGGAGG
GGGAACTCAGGAGATTGATCAACAAACCAGAACATCTCAA
AACTCTGAATGAGAAGAAGAGGGAAACTGAGCTGTTGAAC
AGACTGATGAAGATTGTGAATGACAGAAACGCTATTGTTG
AGGGTCTGGAGGAAGACAGGATAAGGGAGGAGGAGGAAGA
TCAACAGTTGAATGAAATGATGCAAAGACTGGGTCTTCAG
AAGTTTAAAAACAAACGCAAGTCATCCTTCTCAAAGTTAT
TTCGACGACGAAGTAAAAAAGCCTCGATGGGAGAGTGAAG
CTCACAGCTACTAGACTGAAGTGCTCCATATGTTCGGCTG
CAGTTTGTTGAAACTTCATCTTTTTAGATGTTTTAAAAAA
ACAAGGTGGGTCTACAAAATGTCAGGTGGTTTAGTGAGGT
AAGAGTTCTTGAAGTAAAATGTTGTTTATTATTAACTTTT
TATTATTTCAGTCATGTTCAGAAAGTTTTTCACTTTGATT
TACCTAATGCTTGTTCTATTCATTTAAGATGTTTAATTTT
GCTCCTATACTTTCAATGCGTGGGCTCCTTTTGAATAATT
ATTGTTCAGAATATACATTTACTTAACTTCTTTATTTTTA
TTTCCACCCCCTCACTTGTTCGGAGATAAACCGTACCGTT
GTATTAGCAGATAAACAAACAGATGTCCAAGGCTGGCTGA
AGCACGCTCTTTGACTGCCATCCAAAAATCTGCGGAGCAT
CTTAATTTAACCCTAACCTCCAATAAGCGTTGAGCTCAAA
GATTGAAAGCGTTCATTGTGCAGTGCTAACAGTGACCTGA
AGGGGGCACTATGAGCTTGCATGCATGTGCATCAGAATAT
CCAGACTCTTATATCCTGTGAACGCTAAATCAAGCTGGAG
ATTAGACTGCAGAAGATCTTGTGTGTGTGTGTGCGCGCGC
GCTGGAGAGGCACGGATTATTGGTTTTATTCTCTTTTTAA
GTCTCTAACCTAGTTCAATTAAAAGTGTACCTCATTTAAC
TTATCCAAGTAGTAGATGTGCAAAGAGGCCTTTTTTAATG
TTTTAAATAAAAGGTATGACTGAACTGTTTGAAAAAGCTA
CTGCAGGAATGTTTTAAAGATGTTTTAAAAAGTTCTCTGA
AGAGATGCTGATGATGTGCTTATTTATTGTGTATTTGACT
TTAATAACATGGGTTATTCAATAAATCTTAAGGAAGTTTC
TAATTGTATTATAACCAAGGTGAATGCA

micall2a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA micall2a-201 3588
aberrant processed transcript micall2a-202 (1) 3661
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
micall2a-201 Contained in:
[BAC] DKEY-43P13 (1) (order this)

OTHER micall2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027989 (1)
  • Ensembl_Trans:ENSDART00000162096 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA471195 (1) 926 bp
    GenBank:CN502590 (1) 770 bp
    GenBank:CT615799 (1) 769 bp
    GenBank:BQ616694 (1) 706 bp
    GenBank:CT669359 (1) 694 bp
    GenBank:CD595008 (1) 650 bp
    GenBank:CD598486 (1) 650 bp
    GenBank:EB925936 (1) 635 bp
    GenBank:BI877067 (1) 577 bp
    GenBank:AI721788 (1) 555 bp
    GenBank:AI721789 (1) 546 bp
    GenBank:AW134327 (1) 534 bp
    GenBank:BI980154 (1) 505 bp
    GenBank:BM403618 (1) 398 bp
    GenBank:CD591249 (1) 385 bp
    GenBank:BG737552 (1) 323 bp
    CITATIONS (2)