header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10521
Transcript Name: micall2a-202
Previous Names: micall2-001, micall2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027988 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027988|OTTDARG00000021862|ZDB-GENE-030131-5409 micall2a|OTTDARP00000039126 micall2-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 3661 bp
GTCCCCTTCAGTTCATTTTAATCTTAATTTTCGGCGGACG
TTTTCTCTTTACGGCTTCGTAATTTTGTCGGAAAAGACCC
TTTTTAGTTTCCTGTTATTAAAAAACACTTTGCAGTGAGT
AGAGAGAGCGTTTGGAGAGAATGGCGGCTATTAAAGCGCT
CCAGCAGTGGTGTAAAATTCAGTGCGAGGGATACCGAGAT
GTGGCCATCAGCAACATGAGCATGTCTTTCAGAGATGGAC
TGGCCTTCTGTGCGCTCATCCACAAGTTCAGACCGGATCT
CATAAACTTCGAGTCTCTCTCCAAAGACAATGTGTATTAC
AACAATCACTTGGCTTTTCGTGTGGCTGAAGATCATCTGG
GGATCCCTGCTCTTCTGGATGCGGAGGATATGGTGGCCTT
GCCTGTCCCAGACAGACTCAGCATCCTCACATATGTCTCA
CAATACTACAATTACTTCCATGGCCGCTCCCCAATCGGGG
GAGTAGGAGGTATCAAGCGGCACGCTGAGGACTCAAAGGA
GGTGCCATCAGAGAAGAAGAATCTGCCTGTGGTTGCCAAA
AACCACAATCTCAAAACAAATACAGAGAACCGTCCTCCTC
AAAGTGAAATGCCAAAAATTATCAACCGTCCTCCATCTCT
TAACATCCAGAAAAGTGCTCCAGAGAAGCACGCTCTAGCC
ACTCCAGCTCGGCAGACTGGCACAGACCGGCAGAAATCTC
CAGGGCCTAAATGTGTGCAAGCGCCCGTCACACCACTCAG
AGCGAGATCTCCACAACCACACAGAGAAGCTGAGAAGAAG
TCTGTTTTGGTGGAGACCTCAAATAAAACGGGTACATTAA
ACAGTGAATGTGCCGTCTGTGGAAATCATGTACATCTAGT
CCAGAGACACCTGGTGGATGGAAAACTCTACCACCGGAGC
TGCTATAAGTGCAGTGTATGTTATGGCACACTGAAATCTG
GAGCATATAAACTGGGATCAGACACTGGTTCACTCGTCTG
CACTATTCACCAACATGGCCAAAATGGCTTCAAGCCCACT
GTTAAGCCTTTTAAGAGCAGCGGCTTTACAGTTTCTGATT
TGGTGGCCAAATCTGAGCGAGAAGATCAGTCGCCTTCACA
GCGCTACATCTCTGTATTATCTGCACCCATCAAGGCTGTT
CCTAGACCTGTGGAGCTTAGCCTGGCTCAGCAGTCATGGA
CGTCTTCGGCTCAGAGGACTCAAGCAGCTCGGCAGAAGTT
CTTCCAGTCTTGTGCCCCAGCAACAGAGCTTCAGCCCAAT
ACCAAACCACCATTAGGCCCAGCTGAGCCCTCCAATCTGA
AGGTGCAGGAGAAAGAAGGAAACCGTGCTCTGGCGAATGG
AAATCCACTACATGAAGGAAACGCCAATAACAACAATGCA
CTGAATTCTGACCCAAGAGCAAAAAGCCAGGTAAAAATCA
GTTGCTCTTCTGCTGAAGTCTCTACTTGGAGGCAGGAGCT
ACATGTGCGAGATTCAAAAGGCAGGAGTTCATATCAGGCT
GCTCCATCCAGCCCTGCTATTATCAGCAGCGGCGGCGGCA
TGAACGGCAAGGAATCGCTCTACCTCAGTGCCATCAGCAA
GGAGAGCAGCAGACCTCCATCCCTGCTGCAGACTACTGCC
AAAGCTTCAGCCAATGATGTTCAGAGCTACGATGCCCCGG
CTGACTGGAGATCAAAGCCAAAGGCAGCTCCAAATGGACC
AAGACTCAACCGGCGTATGCCTCCTGCCTCCCCCATAGTG
TGCAGAGTGCATCCTCTCGCTCTGTCCCCAATCCTCAACA
GTCCCAACGAGTGCTGCGCCTAAACCAACCCTCTCTGAAA
CCATATACTCTTACCTTGAGTTCTTCTGATGATCCTCCTA
TTTAGTTTTGTGGGCGTCTGCTGTATATAAGTAGATCTCC
TGATATTGCCAAAGATGTTCCATTGACGTGTGGAGAAAAC
AAAGATTTAAAAGTGCAGGATTCTCAAGCCTTCATGTTGA
ACCACTCCAAGGGTTGTAATAATGATTGTTCTTTGGCCTC
ATGCGTATCACCCTCTACGTCCTGTCACAAACTTTCATCT
CCAAAACAGCCTCGCTGCGGGTCAGCGACATCAAGTTACG
ACAATGGAAATATATTATGTAATAACATTTTGCTCCATGA
AGCAAGGTCACCTACTACAAACACTTGCTATATCACGCCA
GAGCAGATCTCAAAAGAACTGCAAGACATTGAAAACAACC
TCAACGATTTGGAGAATGAAGGAGTGGAGCTGGAATGGAA
ACTTCGTGTTTATGAAGAAGAGGGTCATGGGGACATTCTG
ATGGACCCCTTAATGGTTGATTGGTTTAACCTGATTCGGA
AGAAACAAAGCTACATACGGAGAGAGTCGGAGTTGATGTA
CATAGCAAGAACACAAGATCTGGAGGAGCAACAGCCGGGA
GTGGAGGGGGAACTCAGGAGATTGATCAACAAACCAGAAC
ATCTCAAAACTCTGAATGAGAAGAAGAGGGAAACTGAGCT
GTTGAACAGACTGATGAAGATTGTGAATGACAGAAACGCT
ATTGTTGAGGGTCTGGAGGAAGACAGGATAAGGGAGGAGG
AGGAAGATCAACAGTTGAATGAAATGATGCAAAGACTGGG
TCTTCAGAAGTTTAAAAACAAACGCAAGTCATCCTTCTCA
AAGTTATTTCGACGACGAAGTAAAAAAGCCTCGATGGGAG
AGTGAAGCTCACAGCTACTAGACTGAAGTGCTCCATATGT
TCGGCTGCAGTTTGTTGAAACTTCATCTTTTTAGATGTTT
TAAAAAAACAAGGTGGGTCTACAAAATGTCAGGTGGTTTA
GTGAGGTAAGAGTTCTTGAAGTAAAATGTTGTTTATTATT
AACTTTTTATTATTTCAGTCATGTTCAGAAAGTTTTTCAC
TTTGATTTACCTAATGCTTGTTCTATTCATTTAAGATGTT
TAATTTTGCTCCTATACTTTCAATGCGTGGGCTCCTTTTG
AATAATTATTGTTCAGAATATACATTTACTTAACTTCTTT
ATTTTTATTTCCACCCCCTCACTTGTTCGGAGATAAACCG
TACCGTTGTATTAGCAGATAAACAAACAGATGTCCAAGGC
TGGCTGAAGCACGCTCTTTGACTGCCATCCAAAAATCTGC
GGAGCATCTTAATTTAACCCTAACCTCCAATAAGCGTTGA
GCTCAAAGATTGAAAGCGTTCATTGTGCAGTGCTAACAGT
GACCTGAAGGGGGCACTATGAGCTTGCATGCATGTGCATC
AGAATATCCAGACTCTTATATCCTGTGAACGCTAAATCAA
GCTGGAGATTAGACTGCAGAAGATCTTGTGTGTGTGTGTG
CGCGCGCGCTGGAGAGGCACGGATTATTGGTTTTATTCTC
TTTTTAAGTCTCTAACCTAGTTCAATTAAAAGTGTACCTC
ATTTAACTTATCCAAGTAGTAGATGTGCAAAGAGGCCTTT
TTTAATGTTTTAAATAAAAGGTATGACTGAACTGTTTGAA
AAAGCTACTGCAGGAATGTTTTAAAGATGTTTTAAAAAGT
TCTCTGAAGAGATGCTGATGATGTGCTTATTTATTGTGTA
TTTGACTTTAATAACATGGGTTATTCAATAAATCTTAAGG
AAGTTTCTAATTGTATTATAA

micall2a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA micall2a-201 (1) 3588
aberrant processed transcript micall2a-202 3661
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
micall2a-202 Contained in:
[BAC] DKEY-43P13 (1) (order this)

OTHER micall2a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027988 (1)
  • Ensembl_Trans:ENSDART00000165708 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC052767 (1) 3663 bp
    GenBank:DT870170 (1) 791 bp
    CITATIONS (2)