header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1033
Transcript Name: ctgfa-201
Previous Names: ctgf-001, ctgfa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007754 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007754|OTTDARG00000006901|ZDB-GENE-030131-102 ctgfa|OTTDARP00000006861 ctgf-001 LG_ BX323010.9 Danio rerio protein_coding KNOWN, 2119 bp
GTCACTCGACTCGGCTCAGCCTAAACTTCTTACCAAAGCT
AAACTCTAGCTTTCACTCAACACGATCAGGAGGAACTGGA
TTCAAAGACTACACAACGAGATCGACTTGATCAAATCTGA
AGAGAAGACTTTGTAGGATCTCAAAAGAAGATTTTTCTTT
TTGCTACAAACTTTAAAGAAGTCATCATGTTTTCTGGAAT
GACTCAAAGTGTGATTGCTCTGCTGTTCCTGACTTTCTTA
AGATGGGCTGTGGCTCAAGAGTGCAGTGGACAATGCCACT
GCCCTGAAGTGCCGCCCCAGTGTTCACCTGGTGTAAGCCT
AGTTCTGGACACCTGTGGGTGCTGCCGGGTGTGTGCCAAG
CAGCTGGGCGAGCTGTGCACAGAACGAGATGTTTGCGACC
CCCACAAAGGTCTTTACTGTGACTACGGCTCCCCAAGTAA
CCGTCGTATTGGTGTCTGCACAGCCAGAGATGGTGCCACT
TGTGTGTTTGGTGGAATGGTGTACCGCAGTGGAGAGTCTT
TCCAGAGCAGTTGTAAATACCAGTGCACGTGTCTGGACGG
TGCTGTAGGTTGCGTGCCCCTCTGTGGAATGGACATCAGG
CTCCCCAGCCCAGACTGCCCAATGCCCCGCAGGGTGAAAG
TGCCTGGGAAGTGCTGCGAGGAGTGGGTGTGTGACTCCCC
TCGTCAAAACACCTTTGTGGGATCAGCTTTAGCAGCTTAC
AGAGAGGAGGAGACATACGGTCCCGATCCCTCCATGATGA
GAGAGAACTGCCTGGTTCAGACTACAGAATGGAGCGCATG
CTCAAAAACCTGTGGCTTGGGAATCTCTACTCGTGTGACC
AATGACAACCGTGAGTGCCGCCTTGAGAAGCAGTCTCGCC
TTTGCATGGTCCGCCCTTGCGAGTCACACCTGGAGGAGAA
AATAAGGAAAGGGAAAAAGTGCATCCGCACACCACGAGTC
TCCAAACCCATGAAGTTTGAGATTTCCGGCTGTACCACTA
CCAAGTCTTACAGACCCAAGTTCTGCGGCGTTTGCACAGA
TGGTCGCTGTTGCACTCCTCACAGAACCGCCACCTTGCCC
ATGGAGTTCAAGTGCCCCGATGGCCAAGTCATGAAGAAGC
AGATGATGTTCATCAAGACCTGCGCATGCCACTACAACTG
CCCTGGGGAGAACGACATCTTTGAATCCATGTACTACAAG
AAGATGGTTGGCGACATGGCGTGAAAAGTCATGACCTGAC
AAGGAGTTCCATGCAGTGACTGTCCACTTGAATTGAACAG
ATATCCATCTCATATCTCAGCACAAATTACTTGTTTGTCT
TTTTATGGTTTGTTGCTTTCATTTTACGTCTTTTTGCGTG
TATGTGTTTGCATCTTGTTGGTGGACTCTGGATTTCTATG
CTGTATGTGTATTCATTTGTCATGGTGGATGTCTAAGCCT
AGGGGGTGGGGATCGTAAAATGACCGGGCCCTGTTCGGAC
GCCCCTAAAAAACAATACTGCACTATAGTCCGATGCTGTG
ACGCCCAATGTCACTGATTGGCAGATGACGCCAAGCCCCT
CCTCTAAACTGTGGTGAGCAGATTCAGATTCTGAGAGCAA
AAATAGTAAGAAATGGATGGCAGCTTTAACCCCAGAAGCT
AATCGCCTCACCAAGCTAAGAAGGCGGAAAAAAGAGACAG
AGAGAAATTGATGTGCTCTTATGTTTAGTTGATATTGTCA
GCTCAGAGTTTGATTGAGCTGATCCAAGACATGAAGTTTG
GCCAAGAACTATGAAGGTTAATATAGCACTGAGTGTTTGA
CTGTCTGGCCCCTCCTGTTGGGAAAGAGCCAGTATCCCTG
TCAAAAAGACTGGATGAATTGTAGCTTCATTCTTTTTTAT
GACAATATCTATTTTTGAAAGCTGTAAATAATGTACATAT
TTTGTACAGCTTAAGTTAATTTAAATTGAAAGCATTTTGT
CTTCTTATTTCCTTGCTTCGTCATGTTTAATGATAGCTTC
ATGTGCTGACTTGACTATTCTTGGTACAGCTTGTCCAATA
TTTTATTGAGAAGTGTGACCAAAATGTTACATGTTTTCAC
TTTTGTAGTTTACAATAAAATATTATATTTTTATACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctgfa-201 Contained in:

OTHER ctgfa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000007754 (1)
  • Ensembl_Trans:ENSDART00000063028 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115209 (1) 2146bp
    GenBank:CN508887 (1) 810bp
    GenBank:CF998062 (1) 747bp
    GenBank:BM574486 (1) 594bp
    GenBank:BM858829 (1) 593bp
    GenBank:BM858677 (1) 588bp
    GenBank:BM532149 (1) 587bp
    GenBank:BM573472 (1) 586bp
    GenBank:BM572476 (1) 584bp
    GenBank:BM530694 (1) 582bp
    GenBank:BM532673 (1) 582bp
    GenBank:BM858423 (1) 582bp
    GenBank:BM858471 (1) 579bp
    GenBank:BM858742 (1) 569bp
    GenBank:BM530381 (1) 563bp
    GenBank:BM531605 (1) 552bp
    GenBank:BM573338 (1) 550bp
    GenBank:BQ615147 (1) 530bp
    GenBank:CD777991 (1) 525bp
    GenBank:AI354145 (1) 520bp
    CITATIONS (2)