header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-180927-1
TALEN Name: TALEN1-pclaf,cntn1a
Targets: cntn1a (1), pclaf (1)
Previous Name: TALEN1-pclaf

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence 1:
5' - TCCGCGCCCCGGAAATCACT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - CGGAGCATCCGGATCCTCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The TALEN target sequence 100 percent aligned to both pclaf and cntn1a when BLAST analyzed at Ensembl.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-pclaf,cntn1a No data available
GENOMIC FEATURES CREATED WITH TALEN1-pclaf,cntn1a
Genomic Feature Affected Genomic Regions    
ihb495 pclaf    
ihb496 pclaf    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-pclaf,cntn1a No data available
PHENOTYPE
Phenotype resulting from TALEN1-pclaf,cntn1a
No data available

Phenotype of all Fish created by or utilizing TALEN1-pclaf,cntn1a
No data available
Genome Resources:
CITATIONS (1)