header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-180417-4
TALEN Name: TALEN2-lft2
Target: lft2 (1)
Source:
Target Sequence 1:
5' - TTCATCCAGCTGTTCATTTT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TGCTGGAATCCCTGTGTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN2-lft2 No data available
GENOMIC FEATURES CREATED WITH TALEN2-lft2
Genomic Feature Affected Genomic Regions    
a146 lft2    
GENE EXPRESSION
Gene expression in Wild Types + TALEN2-lft2 No data available
PHENOTYPE
Phenotype resulting from TALEN2-lft2
No data available

Phenotype of all Fish created by or utilizing TALEN2-lft2
Phenotype Fish Conditions Figures
endoderm sox17 expression spatial pattern, abnormal lft2a146/a146 standard conditions Fig. 1 with image from Norris et al., 2017
endodermal cell increased amount, abnormal lft2a146/a146 standard conditions Fig. 1 with image from Norris et al., 2017
endoderm sox17 expression increased amount, abnormal lft2a146/a146 standard conditions Fig. 1 with image from Norris et al., 2017
endoderm sox17 expression increased distribution, abnormal lft2a146/a146 standard conditions Fig. 1 with image from Norris et al., 2017
margin ndr1 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
endoderm sox32 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with imageFig. 4 with imageFig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
axis bifurcated, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1-S2 with image from Rogers et al., 2017
axis lft2 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
axis lft2 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
axis noto expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with imageFig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
axis lft1 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
mesoderm noto expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
presumptive mesoderm noto expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
axis lft2 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
heart tube aplastic, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1-S1 with image from Rogers et al., 2017
caudal fin morphology, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S1 with imageFig. 6-S2 with image from Rogers et al., 2017
endoderm sox32 expression spatial pattern, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
whole organism morphology, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
margin lft1 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
axis noto expression amount, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
axis lft1 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
embryonic pattern specification decreased process quality, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1 with image from Rogers et al., 2017
presumptive endoderm sox32 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
margin lft1 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
presumptive mesoderm noto expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
margin ndr1 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
axis noto expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with imageFig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
axis lft1 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
caudal fin curved dorsal, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 6-S1 with image from Rogers et al., 2017
axis ndr2 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
caudal fin decreased length, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1 with imageFig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
eye morphology, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S1 with imageFig. 6-S2 with image from Rogers et al., 2017
eye morphology, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
caudal fin morphology, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1 with imageFig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
heart tube myl7 expression absent, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1-S1 with image from Rogers et al., 2017
endoderm sox32 expression amount, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
whole organism necrotic, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 6 with image from Rogers et al., 2017
margin sox32 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with imageFig. 6-S3 with image from Rogers et al., 2017
mesoderm noto expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
margin sox32 expression decreased amount, abnormal lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6-S3 with image from Rogers et al., 2017
presumptive endoderm sox32 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
margin lft2 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
margin lft2 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
margin lft1 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
whole organism Ab9-smad2 labeling increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 2 with image from Rogers et al., 2017
axis ndr2 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
margin lft2 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
caudal fin aplastic, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1 with image from Rogers et al., 2017
heart aplastic, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1 with image from Rogers et al., 2017
caudal fin length, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S1 with imageFig. 6-S2 with image from Rogers et al., 2017
presumptive endoderm sox32 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
endoderm sox17 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
margin noto expression decreased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 6-S3 with image from Rogers et al., 2017
axis noto expression spatial pattern, ameliorated lft1a145/a145 ; lft2a146/a146 chemical treatment by environment: SB 505124 Fig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
whole organism Ab9-smad2 labeling increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 2 with imageFig. 2-S1 with image from Rogers et al., 2017
eye aplastic, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 1 with imageFig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
presumptive mesoderm noto expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
margin sox32 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
blastodisc anatomical margin lft1 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
endoderm sox17 expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
whole organism decreased length, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
mesoderm noto expression increased amount, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with image from Rogers et al., 2017
axis noto expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with imageFig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
endoderm sox32 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with imageFig. 4 with imageFig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
endoderm sox32 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3 with imageFig. 4 with imageFig. 6 with imageFig. 6-S3 with image from Rogers et al., 2017
whole organism morphology, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 6 with imageFig. 6-S1 with image from Rogers et al., 2017
margin sox32 expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with imageFig. 6-S3 with image from Rogers et al., 2017
endoderm sox17 expression increased distribution, abnormal lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 3-S1 with image from Rogers et al., 2017
caudal fin mesenchyme morphology, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
ventral fin fold mesenchyme morphology, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
heart decreased width, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
blood increased accumulation caudal fin, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
endodermal cell increased amount, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 1 with image from Norris et al., 2017
endoderm sox17 expression spatial pattern, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 1 with image from Norris et al., 2017
heart decreased size, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
endoderm sox17 expression decreased distribution, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 1 with image from Norris et al., 2017
caudal fin blood circulation decreased occurrence, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
caudal fin morphology, abnormal lft2a146/a146 ; apelaa141/a141 standard conditions Fig. 2 with image from Norris et al., 2017
endoderm sox17 expression spatial pattern, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 1 with image from Norris et al., 2017
caudal fin mesenchyme morphology, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
ventral fin fold mesenchyme morphology, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
heart decreased width, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
blood increased accumulation caudal fin, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
endodermal cell increased amount, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 1 with image from Norris et al., 2017
heart decreased size, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
endoderm sox17 expression decreased distribution, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 1 with image from Norris et al., 2017
caudal fin blood circulation decreased occurrence, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
caudal fin morphology, abnormal lft2a146/a146 ; apelaa142/a142 standard conditions Fig. 2 with image from Norris et al., 2017
axis noto expression decreased amount, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
axis bifurcated, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
axis noto expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
margin noto expression decreased distribution, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
margin noto expression spatial pattern, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
margin noto expression decreased amount, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
axis noto expression decreased distribution, abnormal lft1a145/a145 ; lft2a146/a146 ; ndr1cz35/cz35 standard conditions Fig. 4 with image from Rogers et al., 2017
axis curved, abnormal lft1a145/a145 ; ndr1cz35/+ ; lft2a146/+ standard conditions Fig. 4 with image from Rogers et al., 2017
axis curved, abnormal lft2a146/+ ; ndr1cz35/cz35 ; lft1a145/a145 standard conditions Fig. 4 with image from Rogers et al., 2017
whole organism morphology, abnormal lft2a146/a146 ; lft1a145/a145 ; ndr1cz35/+ standard conditions Fig. 4 with image from Rogers et al., 2017
whole organism decreased length, abnormal lft2a146/a146 ; lft1a145/a145 ; ndr1cz35/+ standard conditions Fig. 4 with image from Rogers et al., 2017
notochord kinked, abnormal lft2a146/a146 ; lft1a145/a145 ; ndr1cz35/+ standard conditions Fig. 4 with image from Rogers et al., 2017
caudal fin curved dorsal, abnormal lft2a146/a146 ; lft1a145/a145 ; ndr1cz35/+ standard conditions Fig. 4 with image from Rogers et al., 2017
eye morphology, abnormal lft2a146/a146 ; lft1a145/a145 ; ndr1cz35/+ standard conditions Fig. 4 with image from Rogers et al., 2017
eye aplastic, abnormal lft2a146/a146 ; lft1a145/a145 ; ndr1cz35/+ standard conditions Fig. 4 with image from Rogers et al., 2017
notochord kinked, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/+ standard conditions Fig. 4 with image from Rogers et al., 2017
eye morphology, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/+ standard conditions Fig. 4 with image from Rogers et al., 2017
caudal fin decreased length, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
whole organism morphology, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
notochord kinked, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
whole organism decreased length, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
eye morphology, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
caudal fin morphology, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
eye aplastic, abnormal ndr2m294/+ ; lft1a145/a145 ; lft2a146/a146 standard conditions Fig. 4 with image from Rogers et al., 2017
notochord kinked, abnormal ndr2m294/m294 ; lft2a146/+ ; lft1a145/a145 standard conditions Fig. 4 with image from Rogers et al., 2017
OTHER TALEN2-lft2 TALEN PAGES No links to external sites
CITATIONS (3)