header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-171211-1
TALEN Name: TALEN1-mstnb
Target: mstnb (1)
Source:
Target Sequence 1:
5' - TACACAGGTTTTAATTTCTCT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - ATAACCCACTGGACCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-mstnb No data available
GENOMIC FEATURES CREATED WITH TALEN1-mstnb
Genomic Feature Affected Genomic Regions    
ihb167 mstnb    
zf1027 mstnb    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-mstnb No data available
PHENOTYPE
Phenotype resulting from TALEN1-mstnb
No data available

Phenotype of all Fish created by or utilizing TALEN1-mstnb
Phenotype Fish Conditions Figures
muscle ab-s58 labeling decreased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
muscle myf5 expression increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
muscle myog expression increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
muscle myod1 expression increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
muscle cell hyperplastic, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
skeletal muscle lipid increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 4 with image from Gao et al., 2016
blood glucose increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 4 with image from Gao et al., 2016
whole organism increased weight, abnormal mstnbzf1027/zf1027 standard conditions Fig. 2 with image from Gao et al., 2016
skeletal muscle cell increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
skeletal muscle triglyceride increased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 4 with image from Gao et al., 2016
muscle hyperplastic, abnormal mstnbzf1027/zf1027 standard conditions Fig. 3 with image from Gao et al., 2016
regulation of lipid metabolic process process quality, abnormal mstnbzf1027/zf1027 standard conditions Fig. 5 from Gao et al., 2016
adipose tissue decreased amount, abnormal mstnbzf1027/zf1027 standard conditions Fig. 4 with image from Gao et al., 2016
OTHER TALEN1-mstnb TALEN PAGESNo links to external sites
CITATIONS (2)