ZFIN ID: ZDB-TALEN-170314-2
TALEN Name: TALEN1-ahi1
Target: ahi1 (1)
Source:
Target Sequence 1:
5' - TGTCAGCAGAAAACCAGACAG - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TCCTCCTTGAACTCCTCTACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-ahi1 No data available
GENOMIC FEATURES CREATED WITH TALEN1-ahi1
Genomic Feature Affected Genomic Regions    
lri46 ahi1    
lri47 ahi1    
lri53 ahi1    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-ahi1 No data available
PHENOTYPE
Phenotype resulting from TALEN1-ahi1
No data available

Phenotype of all Fish created by or utilizing TALEN1-ahi1
Phenotype Fish Conditions Figures
post-vent region curved ventral, abnormal ahi1lri46/lri46 standard conditions Fig. 1 with image from Lessieur et al., 2017
retinal cone cell has fewer parts of type retinal cone cell photoreceptor outer segment, abnormal ahi1lri46/lri46 standard conditions Fig. 4 with image from Lessieur et al., 2017
whole organism lacks all parts of type swim bladder, abnormal ahi1lri46/lri46 standard conditions Fig. 1 with image from Lessieur et al., 2017
retinal outer nuclear layer dorsal region decreased thickness, abnormal ahi1lri46/lri46 standard conditions Fig. 4 with image from Lessieur et al., 2017
photoreceptor outer segment layer dorsal region malformed, abnormal ahi1lri46/lri46 standard conditions Fig. 4 with image from Lessieur et al., 2017
retinal cone cell photoreceptor cell outer segment organization decreased process quality, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 7 with image from Lessieur et al., 2017
posterior pronephric duct lacks all parts of type posterior pronephric duct motile cilium, abnormal ahi1lri46/lri46 standard conditions Fig. 2 with image from Lessieur et al., 2017
retinal cone cell development decreased process quality, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 7 with image from Lessieur et al., 2017
retinal cone cell lacks all parts of type retinal cone cell photoreceptor outer segment, abnormal ahi1lri46/lri46 standard conditions Fig. 7 with image from Lessieur et al., 2017
retinal cone cell photoreceptor outer segment irregular spatial pattern, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with image from Lessieur et al., 2017
pronephric duct cilium assembly decreased occurrence, abnormal ahi1lri46/lri46 standard conditions Fig. 2 with image from Lessieur et al., 2017
retinal cone cell photoreceptor disc membrane irregular spatial pattern, abnormal ahi1lri46/lri46 standard conditions Fig. 5 with image from Lessieur et al., 2017
retinal outer nuclear layer zpr-3 labeling mislocalised, abnormal ahi1lri46/lri46 standard conditions Fig. 6 with image from Lessieur et al., 2017
retinal cone cell photoreceptor outer segment decreased length, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 5 with imageFig. 7 with image from Lessieur et al., 2017
retinal cone cell photoreceptor outer segment disorganized, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 5 with image from Lessieur et al., 2017
eye photoreceptor cell photoreceptor connecting cilium cc2d2a expression decreased amount, abnormal ahi1lri46/lri46 standard conditions Fig. 9 with image from Lessieur et al., 2017
OTHER TALEN1-ahi1 TALEN PAGESNo links to external sites
CITATIONS (1)