header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-170113-1
TALEN Name: TALEN2-cyp19a1a
Target: cyp19a1a (1)
Source:
Target Sequence 1:
5' - TGTCTCCTACTGTCGGTTCAT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TTGTAGTAGTTGCTGGCAGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN2-cyp19a1a No data available
GENOMIC FEATURES CREATED WITH TALEN2-cyp19a1a
Genomic Feature Affected Genomic Regions    
umo5 cyp19a1a    
GENE EXPRESSION
Gene expression in Wild Types + TALEN2-cyp19a1a No data available
PHENOTYPE
Phenotype resulting from TALEN2-cyp19a1a
No data available

Phenotype of all Fish created by or utilizing TALEN2-cyp19a1a
OTHER TALEN2-cyp19a1a TALEN PAGESNo links to external sites
CITATIONS (1)