TALEN

TALEN1-irx7

ID
ZDB-TALEN-160204-1
Name
TALEN1-irx7
Previous Names
None
Target
Target Sequence 1
5' - TGGACAGAAACATCAACATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - TTCCAGGTGGGCAGCCTAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el538 irx7
el540 irx7
Expression
Gene expression in Wild Types + TALEN1-irx7
No data available
Phenotype
Phenotype resulting from TALEN1-irx7
No data available
Phenotype of all Fish created by or utilizing TALEN1-irx7
Phenotype Fish Conditions Figures
interhyal-hyosymplectic joint cartilage development increased process quality, abnormal irx7el538/el538 standard conditions Fig. 2 with image,  Fig. 3 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte increased size, abnormal irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint cartilage development increased process quality, abnormal irx7el538/el538 standard conditions Fig. 2 with image,  Fig. 3 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte increased size, abnormal irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
interhyal-hyosymplectic joint malformed, abnormal irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal cartilage fused with interhyal cartilage, abnormal irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
hyosymplectic cartilage fused with interhyal cartilage, abnormal irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
pharyngeal arch 2 skeleton joint acana expression increased amount, abnormal irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
pharyngeal arch 2 skeleton joint col2a1a expression increased amount, abnormal irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal irx7el538/el538 standard conditions Fig. 2 with image,  Fig. 3 with image from Askary et al., 2015
ceratohyal-interhyal joint malformed, abnormal irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte EGFP expression increased amount, abnormal irx7el538/el538; el10Tg; el483Tg standard conditions Fig. 4 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte EGFP expression increased amount, abnormal irx7el538/el538; el10Tg; el483Tg standard conditions Fig. 4 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte EGFP expression increased amount, abnormal irx7el538/el538; el10Tg; nu13Tg standard conditions Fig. 4 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte EGFP expression increased amount, abnormal irx7el538/el538; el10Tg; nu13Tg standard conditions Fig. 4 with image from Askary et al., 2015
ceratohyal cartilage fused with interhyal cartilage, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte increased size, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
interhyal-hyosymplectic joint cartilage development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
interhyal-hyosymplectic joint absent, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
symplectic decreased length, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte increased size, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint absent, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
hyosymplectic cartilage fused with interhyal cartilage, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
Fig. 2 with image from Askary et al., 2015
pharyngeal arch 2 skeleton joint ab1-col2a labeling increased amount, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image,  Fig. 3 with image from Askary et al., 2015
ceratohyal-interhyal joint cartilage development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
pharyngeal arch 2 skeleton lacks all parts of type interhyal-hyosymplectic joint, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint malformed, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
pharyngeal arch 2 skeleton joint EGFP expression decreased amount, abnormal irx7el538/el538; trps1j1271aGt; el10Tg standard conditions Fig. 3 with image from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal irx7el538/el538; trps1j1271aGt; el10Tg standard conditions Fig. 3 with image from Askary et al., 2015
symplectic decreased length, abnormal emx2el586/el586; irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
opercle decreased size, abnormal emx2el586/el586; irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal emx2el586/el586; irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.