header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-141203-1
TALEN Name: TALEN1-lft2
Target: lft2 (1)
Source:
Target Sequence 1:
5' - ATGGGACTCCCCAAATCCCC - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TAATTCATAAATACTTTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This TALEN targets the mir430 binding site in the 3'UTR of lft2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-lft2 No data available
GENOMIC FEATURES CREATED WITH TALEN1-lft2 No data available
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-lft2
Expressed Gene Anatomy Figures
lft2 Fig. 1 from Bassett et al., 2014
PHENOTYPE
Phenotype resulting from TALEN1-lft2
Phenotype of all Fish created by or utilizing TALEN1-lft2
OTHER TALEN1-lft2 TALEN PAGES No links to external sites
CITATIONS (1)