header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-624
SNP Name: rs3729024
Previous Name: zsnp1562 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
NNNNNNNNNNAGCTTCCTTCTCCTCCCTCTCTTTTGTTTGTATCATTTT
Y
AAAAAAGAAATAAGATGACAGCACCTAAACATGAATCTCTGTAGCGGAGTC
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3729024 Contained in: [EST] fj35h01 (1)
[Gene] rtn1b (1)
OTHER rs3729024 SNP PAGES
  • dbSNP:rs3729024 (1)
  • CITATIONS (3)