ZFIN ID: ZDB-SNP-060626-580
SNP Name: rs3728984
Previous Name: zsnp1521 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/C
Sequence:
TGTTTGGCTGAAGAGTGCGGCACTTTATGCTACATAATAACCCAGCGTC
M
TTTACACTGGTCATGTGTGTTCATTAAGTATCAATTGTCAACACGTGCCGG
 (SNP highlighted)
M = A/C
Select Sequence Analysis Tool
Location: Chr: 19 Details
MARKER RELATIONSHIPS
rs3728984 Contained in: [Gene] bloc1s4 (1)
[EST] fa20a04 (1)
OTHER rs3728984 SNP PAGES
  • dbSNP:rs3728984 (1)
  • CITATIONS (2)