header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-1758
SNP Name: rs3728219
Previous Name: zsnp754 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/G
Sequence:
NNNNNNNNNNNGGCAACTCTGCTGGCACTTACAACTGTGGGTTGTGCCG
S
TGTGAGCCTGGGTATCTGGGAGCCCGCTGCGAGTGCCAGGAGGGTGAGGTG
 (SNP highlighted)
S = C/G
Select Sequence Analysis Tool
Location: Chr: 9 Details
MARKER RELATIONSHIPS
rs3728219 Contained in: [EST] fi30h12 (1)
[Gene] itgb5 (1)
OTHER rs3728219 SNP PAGES
  • Ensembl_SNP:rs3728219 (1)
  • CITATIONS (3)