header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-1685
SNP Name: rs3728154
Previous Name: zsnp689 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
CCTCTACAAGGGTAAATTAAATTACTTTTAGAATTTAAACTAATTCAAT
R
AATGATCTCTTTTTTTATGACATCTTTATTTCATGTTTTGCAGGATTCTTC
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3728154 Contained in: [EST] fj05a08 (1)
[Gene] mmp9 (1)
OTHER rs3728154 SNP PAGES
  • Ensembl_SNP:rs3728154 (1)
  • CITATIONS (2)