Regulatory Region
rr.smarca5.s1
- ID
- ZDB-RR-191028-1
- Name
- smarca5 regulatory region s1
- Symbol
- rr.smarca5.s1
- Previous Names
- None
- Type
- regulatory_region
- Location
- Unmapped
- Note
-
Region -5079 to -5093 upstream of smarca5. Sequence: GAGGAGGAGGAAGG. Contains consensus-like CNBP binding sites. A 30 nucleotide fragment that includes the 14 nt motif and 8 nt flanking sequences interacts with CNBP (GCACCCTGGAGGAGGAGGAAGGGTTGGTAG). CNBP immunoprecipitated a fragment including "s1" in ChIP assays.
Mutations and Sequence Targeting Reagent
Mutants
Sequence Targeting Reagents
Gene Ontology
Constructs with Sequences
Interactions and Pathways
Marker Relationships
Sequence Information
Orthology
Citations