header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-191122-1
Morpholino Name: MO1-mir430
Targets: mir430a-2 (1), mir430a-3 (1), mir430a-4 (1), mir430a-5 (1), mir430a-6 (1), mir430a-7 (1), mir430a-8 (1), mir430a-11 (1), mir430a-12 (1), mir430a-13 (1), mir430a-15 (1), mir430a-17 (1), mir430a-18 (1), mir430b-4 (1), mir430b-5 (1), mir430b-6 (1), mir430b-7 (1), mir430b-8 (1), mir430b-10 (1), mir430b-11 (1), mir430b-12 (1), mir430b-13 (1), mir430b-14 (1), mir430b-15 (1), mir430b-16 (1), mir430b-17 (1), mir430b-18 (1), mir430b-19 (1), mir430b-20 (1), mir430c-2 (1), mir430c-6 (1), mir430c-7 (1), mir430c-8 (1), mir430c-10 (1), mir430c-11 (1), mir430c-12 (1), mir430c-13 (1), mir430c-14 (1), mir430c-15 (1), mir430c-16 (1), mir430c-17 (1), mir430c-18 (1)
Sequence:
5' - CACACGCATCTTGTTGTCTGCTGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 4 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mir430 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mir430 No data available
PHENOTYPE
Phenotype resulting from MO1-mir430
No data available

Phenotype of all Fish created by or utilizing MO1-mir430
No data available
Genome Resources:
CITATIONS (1)