Morpholino

MO9-fgf3

ID

ZDB-MRPHLNO-191030-1

Name

MO9-fgf3

Previous Names

None

Target

Sequence

5' - CCCGACGTGACATAACACTTACTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO9-fgf3

Phenotype

Phenotype resulting from MO9-fgf3

Phenotype	Fish	Figures
hypothalamus etv5b expression decreased amount, abnormal	AB + MO9-fgf3	Fig. 2. from Reuter et al., 2019
hypothalamus ab1-serotonin labeling decreased distribution, abnormal	AB + MO9-fgf3	Fig. 3. from Reuter et al., 2019
hypothalamus avp expression decreased distribution, abnormal	AB + MO9-fgf3	Fig. 4. from Reuter et al., 2019
hypothalamus nkx2.4b expression decreased distribution, abnormal	AB + MO9-fgf3	Fig. 5. from Reuter et al., 2019
hypothalamus ab3-th labeling decreased distribution, abnormal	AB + MO9-fgf3	Fig. 3. from Reuter et al., 2019
hypothalamus decreased size, abnormal	AB + MO9-fgf3	Fig. 5. from Reuter et al., 2019
hypothalamus ab11-casp3 labeling increased distribution, abnormal	AB + MO9-fgf3	Fig. 6. from Reuter et al., 2019
hypothalamus cell death increased occurrence, abnormal	AB + MO9-fgf3	Fig. 6. from Reuter et al., 2019
hypothalamus cell population proliferation decreased occurrence, abnormal	AB + MO9-fgf3	Fig. 6. from Reuter et al., 2019
hypothalamus dopaminergic neuron decreased amount, abnormal	AB + MO9-fgf3	Fig. 3. from Reuter et al., 2019
hypothalamus serotonergic neuron decreased amount, abnormal	AB + MO9-fgf3	Fig. 3. from Reuter et al., 2019
otolith fused with otolith, abnormal	AB + MO9-fgf3	Fig. S3 from Reuter et al., 2019
ventral mandibular arch malformed, abnormal	AB + MO9-fgf3	Fig. S3 from Reuter et al., 2019

Phenotype of all Fish created by or utilizing MO9-fgf3

Phenotype	Fish	Conditions	Figures
hypothalamus decreased size, abnormal	AB + MO9-fgf3	control	Fig. 5. from Reuter et al., 2019
hypothalamus ab11-casp3 labeling increased distribution, abnormal	AB + MO9-fgf3	control	Fig. 6. from Reuter et al., 2019
hypothalamus ab1-serotonin labeling decreased distribution, abnormal	AB + MO9-fgf3	control	Fig. 3. from Reuter et al., 2019
hypothalamus dopaminergic neuron decreased amount, abnormal	AB + MO9-fgf3	control	Fig. 3. from Reuter et al., 2019
hypothalamus cell death increased occurrence, abnormal	AB + MO9-fgf3	control	Fig. 6. from Reuter et al., 2019
ventral mandibular arch malformed, abnormal	AB + MO9-fgf3	control	Fig. S3 from Reuter et al., 2019
hypothalamus cell population proliferation decreased occurrence, abnormal	AB + MO9-fgf3	control	Fig. 6. from Reuter et al., 2019
hypothalamus etv5b expression decreased amount, abnormal	AB + MO9-fgf3	control	Fig. 2. from Reuter et al., 2019
hypothalamus ab3-th labeling decreased distribution, abnormal	AB + MO9-fgf3	control	Fig. 3. from Reuter et al., 2019
hypothalamus avp expression decreased distribution, abnormal	AB + MO9-fgf3	control	Fig. 4. from Reuter et al., 2019
hypothalamus nkx2.4b expression decreased distribution, abnormal	AB + MO9-fgf3	control	Fig. 5. from Reuter et al., 2019
hypothalamus serotonergic neuron decreased amount, abnormal	AB + MO9-fgf3	control	Fig. 3. from Reuter et al., 2019
otolith fused with otolith, abnormal	AB + MO9-fgf3	control	Fig. S3 from Reuter et al., 2019

Citations