Morpholino

MO1-pou6f1

ID
ZDB-MRPHLNO-190621-1
Name
MO1-pou6f1
Previous Names
None
Target
Sequence
5' - CTCAGTGTCCATGATGATGAAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pou6f1
Expressed Gene Anatomy Figures
bmp4 Fig. 4 with image,  Fig. 6 with image from Bhakta et al., 2018
myh6 Fig. 4 with image,  Fig. 6 with image from Bhakta et al., 2018
myh7 Fig. 4 with image,  Fig. 6 with image from Bhakta et al., 2018
notch1b Fig. 6 with image from Bhakta et al., 2018
nppa Fig. 5 with image,  Fig. 6 with image from Bhakta et al., 2018
tp53 Fig. 4 with image from Bhakta et al., 2018
vcana Fig. 6 with image from Bhakta et al., 2018
Phenotype
Phenotype resulting from MO1-pou6f1
Phenotype Fish Figures
atrioventricular canal increased length, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal malformed, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal nppa expression mislocalised, abnormal AB + MO1-pou6f1 Fig. 5 with image,  Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal cardiac muscle cell development decreased process quality, abnormal AB + MO1-pou6f1 Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal myocardium bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal myocardium vcana expression decreased amount, abnormal AB + MO1-pou6f1 Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 Fig. 4 with image,  Fig. 6 with image from Bhakta et al., 2018
blood circulation decreased occurrence, abnormal AB + MO1-pou6f1 Fig. 3 with image from Bhakta et al., 2018
heart edematous, abnormal AB + MO1-pou6f1 Fig. 3 with image,  Fig. 4 with image from Bhakta et al., 2018
heart malformed, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
heart contraction decreased frequency, abnormal AB + MO1-pou6f1 Fig. 3 with image,  Fig. 4 with image from Bhakta et al., 2018
heart looping decreased occurrence, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
heart morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
whole organism bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
whole organism myh7 expression increased amount, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
whole organism myh6 expression increased amount, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
Phenotype of all Fish created by or utilizing MO1-pou6f1
Phenotype Fish Conditions Figures
whole organism myh6 expression increased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal increased length, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
blood circulation decreased occurrence, abnormal AB + MO1-pou6f1 standard conditions Fig. 3 with image from Bhakta et al., 2018
heart looping decreased occurrence, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal myocardium bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 6 with image from Bhakta et al., 2018
heart malformed, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image,  Fig. 6 with image from Bhakta et al., 2018
heart morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
heart contraction decreased frequency, abnormal AB + MO1-pou6f1 standard conditions Fig. 3 with image,  Fig. 4 with image from Bhakta et al., 2018
whole organism myh7 expression increased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
whole organism bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal myocardium vcana expression decreased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal malformed, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
heart edematous, abnormal AB + MO1-pou6f1 standard conditions Fig. 3 with image,  Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal cardiac muscle cell development decreased process quality, abnormal AB + MO1-pou6f1 standard conditions Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal nppa expression mislocalised, abnormal AB + MO1-pou6f1 standard conditions Fig. 5 with image,  Fig. 6 with image from Bhakta et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.