ZFIN ID: ZDB-MRPHLNO-181205-2
Morpholino Name: MO2-myca
Target: myca (1)
Sequence:
5' - AACTCGCACTCACCGGCATTTTGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. This morpholino contains a SNP when compared to the sequence in Ensembl.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-myca No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-myca No data available
PHENOTYPE
Phenotype resulting from MO2-myca
No data available

Phenotype of all Fish created by or utilizing MO2-myca
No data available
OTHER MO2-myca MORPHOLINO PAGESNo links to external sites
CITATIONS (1)