ZFIN ID: ZDB-MRPHLNO-181114-3
Morpholino Name: MO3-pmela
Target: pmela (1)
Sequence:
5' - AAGATGAGAGATGTCCACATGATGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pmela No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pmela No data available
PHENOTYPE
Phenotype resulting from MO3-pmela
Phenotype Figures
melanocyte decreased amount, abnormal Fig. 3 with image from Yang et al., 2018
whole organism decreased pigmentation, abnormal Fig. 3 with image from Yang et al., 2018

Phenotype of all Fish created by or utilizing MO3-pmela
Phenotype Fish Conditions Figures
melanocyte decreased amount, abnormal TU + MO3-pmela standard conditions Fig. 3 with image from Yang et al., 2018
whole organism decreased pigmentation, abnormal TU + MO3-pmela standard conditions Fig. 3 with image from Yang et al., 2018
OTHER MO3-pmela MORPHOLINO PAGESNo links to external sites
CITATIONS (1)