ZFIN ID: ZDB-MRPHLNO-181114-2
Morpholino Name: MO3-tyr
Target: tyr (1)
Sequence:
5' - AGGAGAGTGAGACGCTTCACACACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tyr No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tyr No data available
PHENOTYPE
Phenotype resulting from MO3-tyr
Phenotype Figures
melanocyte decreased amount, abnormal Fig. 3 with image from Yang et al., 2018
whole organism decreased pigmentation, abnormal Fig. 3 with image from Yang et al., 2018

Phenotype of all Fish created by or utilizing MO3-tyr
Phenotype Fish Conditions Figures
melanocyte decreased amount, abnormal TU + MO3-tyr standard conditions Fig. 3 with image from Yang et al., 2018
whole organism decreased pigmentation, abnormal TU + MO3-tyr standard conditions Fig. 3 with image from Yang et al., 2018
OTHER MO3-tyr MORPHOLINO PAGESNo links to external sites
CITATIONS (1)