header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-180920-3
Morpholino Name: MO2-kita
Target: kita (1)
Sequence:
5' - AAAGTTTTCACTTACTGATGACATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-kita No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-kita
Expressed Gene Anatomy Figures
gata2b Fig. 1 with image from Mahony et al., 2018
mfap4 Fig. S1 with image from Mahony et al., 2018
mpx Fig. S1 with image from Mahony et al., 2018
myb Fig. 1 with image from Mahony et al., 2018
rag1 Fig. S1 with image from Mahony et al., 2018
runx1 Fig. 1 with image from Mahony et al., 2018
PHENOTYPE
Phenotype resulting from MO2-kita
Phenotype of all Fish created by or utilizing MO2-kita
OTHER MO2-kita MORPHOLINO PAGESNo links to external sites
CITATIONS (1)