header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-180918-1
Morpholino Name: MO2-cyp19a1a
Target: cyp19a1a (1)
Sequence:
5' - GGAGCAGATCACCTGCCATAAGAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-cyp19a1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-cyp19a1a
Expressed Gene Anatomy Figures
tph2 Fig. 4 from Ulhaq et al., 2018
PHENOTYPE
Phenotype resulting from MO2-cyp19a1a
Phenotype of all Fish created by or utilizing MO2-cyp19a1a
Phenotype Fish Conditions Figures
behavior process quality, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: fluoxetine Fig. 5 from Ulhaq et al., 2018
whole organism tph2 expression amount, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: 17beta-estradiol Fig. 4 from Ulhaq et al., 2018
behavior process quality, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: 17beta-estradiol Fig. 5 from Ulhaq et al., 2018
behavior process quality, abnormal WT + MO2-cyp19a1a control Fig. 5 from Ulhaq et al., 2018
heart contraction decreased rate, abnormal WT + MO2-cyp19a1a control Fig. 5 from Ulhaq et al., 2018
heart contraction rate, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: 17beta-estradiol Fig. 5 from Ulhaq et al., 2018
raphe nucleus ab2-serotonin labeling amount, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: 17beta-estradiol Fig. 4 from Ulhaq et al., 2018
raphe nucleus ab2-serotonin labeling decreased distribution, abnormal WT + MO2-cyp19a1a standard conditions Fig. 4 from Ulhaq et al., 2018
diencephalon ab2-serotonin labeling decreased distribution, abnormal WT + MO2-cyp19a1a standard conditions Fig. 4 from Ulhaq et al., 2018
whole organism tph2 expression decreased amount, abnormal WT + MO2-cyp19a1a control Fig. 4 from Ulhaq et al., 2018
heart contraction rate, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: fluoxetine Fig. 5 from Ulhaq et al., 2018
diencephalon ab2-serotonin labeling amount, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: 17beta-estradiol Fig. 4 from Ulhaq et al., 2018
behavior process quality, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: serotonergic agonist Fig. 5 from Ulhaq et al., 2018
heart contraction rate, ameliorated WT + MO2-cyp19a1a chemical treatment by environment: serotonergic agonist Fig. 5 from Ulhaq et al., 2018
OTHER MO2-cyp19a1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)