Morpholino

MO2-cyp19a1a

ID

ZDB-MRPHLNO-180918-1

Name

MO2-cyp19a1a

Previous Names

None

Target

cyp19a1a (1)

Sequence

5' - GGAGCAGATCACCTGCCATAAGAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cyp19a1a

Expressed Gene	Anatomy	Figures
tph2	whole organism	Fig. 4 from Ulhaq et al., 2018

Phenotype

Phenotype resulting from MO2-cyp19a1a

Phenotype	Fish	Figures
behavior process quality, abnormal	WT + MO2-cyp19a1a	Fig. 5 from Ulhaq et al., 2018
diencephalon ab2-serotonin labeling decreased distribution, abnormal	WT + MO2-cyp19a1a	Fig. 4 from Ulhaq et al., 2018
heart contraction decreased rate, abnormal	WT + MO2-cyp19a1a	Fig. 5 from Ulhaq et al., 2018
raphe nucleus ab2-serotonin labeling decreased distribution, abnormal	WT + MO2-cyp19a1a	Fig. 4 from Ulhaq et al., 2018
whole organism tph2 expression decreased amount, abnormal	WT + MO2-cyp19a1a	Fig. 4 from Ulhaq et al., 2018

Phenotype of all Fish created by or utilizing MO2-cyp19a1a

Phenotype	Fish	Conditions	Figures
behavior process quality, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: fluoxetine	Fig. 5 from Ulhaq et al., 2018
whole organism tph2 expression amount, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: 17beta-estradiol	Fig. 4 from Ulhaq et al., 2018
behavior process quality, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: 17beta-estradiol	Fig. 5 from Ulhaq et al., 2018
behavior process quality, abnormal	WT + MO2-cyp19a1a	control	Fig. 5 from Ulhaq et al., 2018
heart contraction decreased rate, abnormal	WT + MO2-cyp19a1a	control	Fig. 5 from Ulhaq et al., 2018
heart contraction rate, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: 17beta-estradiol	Fig. 5 from Ulhaq et al., 2018
raphe nucleus ab2-serotonin labeling amount, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: 17beta-estradiol	Fig. 4 from Ulhaq et al., 2018
raphe nucleus ab2-serotonin labeling decreased distribution, abnormal	WT + MO2-cyp19a1a	standard conditions	Fig. 4 from Ulhaq et al., 2018
diencephalon ab2-serotonin labeling decreased distribution, abnormal	WT + MO2-cyp19a1a	standard conditions	Fig. 4 from Ulhaq et al., 2018
whole organism tph2 expression decreased amount, abnormal	WT + MO2-cyp19a1a	control	Fig. 4 from Ulhaq et al., 2018
heart contraction rate, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: fluoxetine	Fig. 5 from Ulhaq et al., 2018
diencephalon ab2-serotonin labeling amount, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: 17beta-estradiol	Fig. 4 from Ulhaq et al., 2018
behavior process quality, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: serotonergic agonist	Fig. 5 from Ulhaq et al., 2018
heart contraction rate, ameliorated	WT + MO2-cyp19a1a	chemical treatment by environment: serotonergic agonist	Fig. 5 from Ulhaq et al., 2018

Citations