Morpholino

MO1-ipo13b

ID

ZDB-MRPHLNO-180912-1

Name

MO1-ipo13b

Previous Names

Target

Sequence

5' - TGTGTCCGAATCCATCTCCGTGTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ipo13b

No data available

Phenotype

Phenotype resulting from MO1-ipo13b

Phenotype	Fish	Figures
eye decreased area, abnormal	AB + MO1-ipo13b	Fig. 3 from Huang et al., 2018
eye decreased diameter, abnormal	AB + MO1-ipo13b	Fig. 3 from Huang et al., 2018
eye decreased size, abnormal	AB + MO1-ipo13b	Fig. 3 from Huang et al., 2018
lens opaque, abnormal	AB + MO1-ipo13b	Fig. S3 from Huang et al., 2018
optokinetic behavior process quality, abnormal	AB + MO1-ipo13b	Fig. S4 from Huang et al., 2018
retina layer formation disrupted, abnormal	AB + MO1-ipo13b	Fig. 4 from Huang et al., 2018
retinal inner plexiform layer absent, abnormal	AB + MO1-ipo13b	Fig. 4 from Huang et al., 2018
retinal inner plexiform layer zpr-1 labeling absent, abnormal	AB + MO1-ipo13b	Fig. 3 from Huang et al., 2018
retinal outer plexiform layer zpr-1 labeling absent, abnormal	AB + MO1-ipo13b	Fig. 3 from Huang et al., 2018
retinal outer plexiform layer absent, abnormal	AB + MO1-ipo13b	Fig. 4 from Huang et al., 2018
trunk curved, abnormal	AB + MO1-ipo13b	Fig. 3 from Huang et al., 2018

Phenotype of all Fish created by or utilizing MO1-ipo13b

Phenotype	Fish	Conditions	Figures
eye decreased area, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 3 from Huang et al., 2018
eye decreased size, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 3 from Huang et al., 2018
retinal outer plexiform layer zpr-1 labeling absent, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 3 from Huang et al., 2018
retinal inner plexiform layer zpr-1 labeling absent, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 3 from Huang et al., 2018
retinal outer plexiform layer absent, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 4 from Huang et al., 2018
visual behavior process quality, abnormal	AB + MO1-ipo13b	lighting conditions	Fig. 5 from Huang et al., 2018
retinal inner plexiform layer absent, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 4 from Huang et al., 2018
eye decreased diameter, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 3 from Huang et al., 2018
lens opaque, abnormal	AB + MO1-ipo13b	standard conditions	Fig. S3 from Huang et al., 2018
retina layer formation disrupted, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 4 from Huang et al., 2018
optokinetic behavior process quality, abnormal	AB + MO1-ipo13b	standard conditions	Fig. S4 from Huang et al., 2018
trunk curved, abnormal	AB + MO1-ipo13b	standard conditions	Fig. 3 from Huang et al., 2018

Citations