header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-180802-1
Morpholino Name: MO3-pmm2
Target: pmm2 (1)
Sequence:
5' - CTGTCAACCTTACCTTTTTTTAGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pmm2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pmm2
Expressed Gene Anatomy Figures
gstp1 Fig. 3 with image from Mukaigasa et al., 2018
PHENOTYPE
Phenotype resulting from MO3-pmm2
Phenotype of all Fish created by or utilizing MO3-pmm2
OTHER MO3-pmm2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)