Morpholino

MO2-cbsb

ID

ZDB-MRPHLNO-180727-2

Name

MO2-cbsb

Previous Names

CBSB-S1 (1)

Target

cbsb (1)

Sequence

5' - CCTGTGAGAAAAAGCTGCATTTGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cbsb

No data available

Phenotype

Phenotype resulting from MO2-cbsb

Phenotype	Fish	Figures
brain homocysteine increased amount, abnormal	WT + MO2-cbsb	Fig. S7 from Prabhudesai et al., 2018
head edematous, abnormal	WT + MO2-cbsb	Fig. 3 from Prabhudesai et al., 2018
trunk bent, abnormal	WT + MO2-cbsb	Fig. 3 from Prabhudesai et al., 2018
whole organism dead, abnormal	WT + MO2-cbsb	Fig. 3 from Prabhudesai et al., 2018
whole organism Ab2-cbs labeling decreased amount, abnormal	WT + MO2-cbsb	Fig. 4 from Dey et al., 2020
whole organism decreased life span, abnormal	WT + MO2-cbsb	Fig. 3 from Prabhudesai et al., 2018
whole organism Ab4-hif1a labeling increased amount, abnormal	WT + MO2-cbsb	Fig. 4 from Dey et al., 2020
whole organism anterior-posterior axis shortened, abnormal	WT + MO2-cbsb	Fig. 3 , Fig. 4 from Prabhudesai et al., 2018

Phenotype of all Fish created by or utilizing MO2-cbsb

Phenotype	Fish	Conditions	Figures
whole organism Ab2-cbs labeling decreased amount, abnormal	WT + MO2-cbsb	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
head edematous, abnormal	WT + MO2-cbsb	chemical treatment by environment: amino-acid betaine	Fig. 6 from Prabhudesai et al., 2018
whole organism anterior-posterior axis shortened, abnormal	WT + MO2-cbsb	standard conditions	Fig. 3 , Fig. 4 from Prabhudesai et al., 2018
whole organism dead, abnormal	WT + MO2-cbsb	standard conditions	Fig. 3 from Prabhudesai et al., 2018
brain homocysteine increased amount, abnormal	WT + MO2-cbsb	standard conditions	Fig. S7 from Prabhudesai et al., 2018
head edematous, abnormal	WT + MO2-cbsb	standard conditions	Fig. 3 from Prabhudesai et al., 2018
whole organism anterior-posterior axis shortened, abnormal	WT + MO2-cbsb	chemical treatment by environment: sodium dithionite	Fig. 6 from Prabhudesai et al., 2018
whole organism Ab4-hif1a labeling amount, ameliorated	WT + MO2-cbsb	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
head edematous, abnormal	WT + MO2-cbsb	chemical treatment by environment: sodium dithionite	Fig. 6 from Prabhudesai et al., 2018
whole organism Ab2-cbs labeling decreased amount, abnormal	WT + MO2-cbsb	standard conditions	Fig. 4 from Dey et al., 2020
whole organism anterior-posterior axis length, ameliorated	WT + MO2-cbsb	chemical treatment by environment: amino-acid betaine	Fig. 6 from Prabhudesai et al., 2018
whole organism Ab4-hif1a labeling increased amount, abnormal	WT + MO2-cbsb	standard conditions	Fig. 4 from Dey et al., 2020
trunk bent, abnormal	WT + MO2-cbsb	standard conditions	Fig. 3 from Prabhudesai et al., 2018
whole organism decreased life span, abnormal	WT + MO2-cbsb	standard conditions	Fig. 3 from Prabhudesai et al., 2018

Citations