ZFIN ID: ZDB-MRPHLNO-180514-1
Morpholino Name: MO1-arhgef19
Target: arhgef19 (1)
Sequence:
5' - GAGAGATTCCATAGCCAGGAAGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-arhgef19 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-arhgef19
Expressed Gene Anatomy Figures
en2a Fig. 2 with image from Miles et al., 2017
PHENOTYPE
Phenotype resulting from MO1-arhgef19
Phenotype Figures
periderm cell increased size, abnormal Fig. 3 with image from Miles et al., 2017

Phenotype of all Fish created by or utilizing MO1-arhgef19
Phenotype Fish Conditions Figures
periderm cell increased size, abnormal TU + MO1-arhgef19 standard conditions Fig. 3 with image from Miles et al., 2017
whole organism anterior-posterior axis decreased length, abnormal TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
neural tube closure incomplete, abnormal TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
periderm cell increased size, exacerbated TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 3 with image from Miles et al., 2017
OTHER MO1-arhgef19 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)