Morpholino

MO1-dre-mir-130a-1

ID

ZDB-MRPHLNO-180507-1

Name

MO1-dre-mir-130a-1

Previous Names

Target

Sequence

5' - CAATGCCCTTTTAACATTGCACTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino also targets mir130c-1 and mir130c-2 with a one nucleotide mismatch.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dre-mir-130a-1

Expressed Gene	Anatomy	Figures
cdh5	intersegmental vessel	Fig. 4 from Singh et al., 2017
hoxa5a	whole organism	Fig. 5 from Singh et al., 2017
jarid2a	vasculature whole organism	Fig. 5 from Singh et al., 2017
kdrl	endothelial cell intersegmental vessel	Fig. 4 from Singh et al., 2017
tek	endothelial cell	Fig. 4 from Singh et al., 2017

Phenotype

Phenotype resulting from MO1-dre-mir-130a-1

Phenotype	Fish	Figures
endothelial cell tek expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 from Singh et al., 2017
endothelial cell kdrl expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 from Singh et al., 2017
intersegmental vessel kdrl expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 from Singh et al., 2017
intersegmental vessel cdh5 expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 from Singh et al., 2017
intersegmental vessel incomplete structure, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 from Singh et al., 2017
intersegmental vessel morphology, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. S3 from Singh et al., 2017
trunk vasculature morphology, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 , Fig. S3 from Singh et al., 2017
vasculature EGFP expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 4 from Singh et al., 2017
vasculature jarid2a expression increased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 5 from Singh et al., 2017
whole organism hoxa5a expression increased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 5 from Singh et al., 2017
whole organism jarid2a expression increased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	Fig. 5 from Singh et al., 2017

Phenotype of all Fish created by or utilizing MO1-dre-mir-130a-1

Phenotype	Fish	Conditions	Figures
endothelial cell tek expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 from Singh et al., 2017
intersegmental vessel kdrl expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 from Singh et al., 2017
vasculature jarid2a expression increased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 5 from Singh et al., 2017
vasculature EGFP expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 from Singh et al., 2017
whole organism jarid2a expression increased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 5 from Singh et al., 2017
intersegmental vessel incomplete structure, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 from Singh et al., 2017
endothelial cell kdrl expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 from Singh et al., 2017
intersegmental vessel cdh5 expression decreased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 from Singh et al., 2017
trunk vasculature morphology, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 4 , Fig. S3 from Singh et al., 2017
whole organism hoxa5a expression increased amount, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. 5 from Singh et al., 2017
intersegmental vessel morphology, abnormal	y1Tg + MO1-dre-mir-130a-1	standard conditions	Fig. S3 from Singh et al., 2017

Citations