ZFIN ID: ZDB-MRPHLNO-180123-2
Morpholino Name: MO2-zbtb17
Target: zbtb17 (1)
Previous Name: SD4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TACAAGACAGAATTTACCTTCTGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-zbtb17 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-zbtb17 No data available
PHENOTYPE
Phenotype resulting from MO2-zbtb17
No data available

Phenotype of all Fish created by or utilizing MO2-zbtb17
Phenotype Fish Conditions Figures
whole organism gh1 expression decreased amount, abnormal TU + MO2-zbtb17 standard conditions Fig. 2 with image from Lawir et al., 2017
T cell differentiation decreased occurrence, abnormal TU + MO2-zbtb17 standard conditions Fig. 2 with image from Lawir et al., 2017
adenohypophysis gh1 expression decreased amount, abnormal TU + MO2-zbtb17 standard conditions Fig. 2 with image from Lawir et al., 2017
thymus T cell rag1 expression decreased amount, abnormal TU + MO2-zbtb17 standard conditions Fig. 2 with image from Lawir et al., 2017
whole organism rag1 expression decreased amount, abnormal TU + MO2-zbtb17 standard conditions Fig. 2 with image from Lawir et al., 2017
OTHER MO2-zbtb17 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)