Morpholino

MO5-lrp5

ID

ZDB-MRPHLNO-171214-1

Name

MO5-lrp5

Previous Names

None

Target

lrp5 (1)

Sequence

5' - CGGGCTTTAATTCCATAATCCCAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-lrp5

No data available

Phenotype

Phenotype resulting from MO5-lrp5

No data available

Phenotype of all Fish created by or utilizing MO5-lrp5

Phenotype	Fish	Conditions	Figures
whole organism sox2 expression decreased amount, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 5 from Xia et al., 2017
otic vesicle cell population proliferation decreased occurrence, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 5 from Xia et al., 2017
otolith decreased amount, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
startle response process quality, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 4 from Xia et al., 2017
whole organism lef1 expression decreased amount, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 5 from Xia et al., 2017
whole organism axin2 expression decreased amount, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 5 from Xia et al., 2017
otic vesicle decreased size, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
inner ear morphology, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
whole organism myca expression decreased amount, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 5 from Xia et al., 2017
swimming behavior process quality, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 4 from Xia et al., 2017
otolith absent, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
sensory perception of sound disrupted, abnormal	WT + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 4 from Xia et al., 2017
neuromast support cell decreased amount, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
neuromast hair cell stereocilium decreased thickness, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
neuromast decreased size, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
posterior lateral line neuromast decreased amount, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
neuromast hair cell decreased amount, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
neuromast hair cell stereocilium decreased length, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017
neuromast hair cell stereocilium decreased amount, abnormal	s356tTg + MO5-lrp5 + MO6-lrp5	standard conditions	Fig. 3 from Xia et al., 2017

Citations