ZFIN ID: ZDB-MRPHLNO-171211-4
Morpholino Name: MO5-bves
Target: bves (1)
Sequence:
5' - CAATAGATGGCGCTGTGTACCTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-bves No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-bves No data available
PHENOTYPE
Phenotype resulting from MO5-bves
Phenotype Figures
cardiac ventricle decreased functionality, abnormal Fig. S2-6 from Wang et al., 2016
cardiac ventricle action potential process quality, abnormal Fig. S2-6 from Wang et al., 2016

Phenotype of all Fish created by or utilizing MO5-bves
Phenotype Fish Conditions Figures
cardiac ventricle decreased functionality, abnormal AB/TU + MO5-bves standard conditions Fig. S2-6 from Wang et al., 2016
cardiac ventricle action potential process quality, abnormal AB/TU + MO5-bves standard conditions Fig. S2-6 from Wang et al., 2016
OTHER MO5-bves MORPHOLINO PAGESNo links to external sites
CITATIONS (1)